Crassula ovata

(Mill.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records1 991

Data sources12

Biological traits39

DNA specimens6

eDNA detections5

Sources12 archives

Databases and archives Crassula ovata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Chemical compositionLOTUS · NPASS2 compounds

Occurrence & distributionGBIF1 991 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Crassula ovata ou Arbre de Jade, Crassule ovale, est une espèce de plantes succulentes de la famille des Crassulaceae, originaire d'Afrique du Sud et commune dans les régions tempérées comme plante d'intérieur, et ailleurs comme plante ornementale de jardin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Leaf length25 mm

Leaf length max90 mm

Leaf length min30 mm

Leaf width14 mm

Leaf width max40 mm

Leaf width min18 mm

Petiole length0.2 cm

Plant height1.5 m

⚠ sources differ — AusTraits: 1.5 m · TRY: 0.6 m

Plant height max2.5 m

Plant height min1 m

Seed mass0.018 mg

⚠ sources differ — TRY: 0.018 mg · GIFT: 0.015 mg

Seed mass max0.02 mg

Seed mass min0.01 mg

Life cycle & reproduction9

Deciduousnessevergreen

Flower colourpink

Flower length max7 mm

Flower width max15 mm

Flowering endApr

Flowering startJan

Life formsucculent subshrub or shrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

Leaf compoundnesssimple

Leaf formobovate

Leaf shapeelliptical oblanceolate

Succulenceyes

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Leaf arrangementopposite

03Chemical composition2 compounds

Compounds documented for Crassula ovata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavan-3-ols $ Proanthocyanins1

Flavonols1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Mearnsetin		present	NPASS
Prodelphiniline		present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula ovata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences4

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536429.1 ↗367 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACAAT …

Crassula ovata voucher MO:Carlsen3405 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcLa★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Crassula ovata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–422n range42median42mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 423×CCDB · book-ipcn73-74 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · book-fedorov — Uhl 1948

CCDB · book-atlas-flowering-plants — Uhl 1948

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 991 records

Wild obs. + sensor1 806

Museum / vouchered150

Cultivated / captive5

Other30

Origin

Native34

Introduced158

Range

Area of Occupancy AOO4 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 150≤1 km 280≤10 km 63>10 km 35

1 528 georeferenced · 278 without coordinates

Open the mapobservation + sensor1 806

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 13≤1 km 17≤10 km 7>10 km 1

38 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence150

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	31
San Diego, US	15
Auckland, NZ	12
BDBClocation not on record	7
Museo Entomologico de Leonlocation not on record	7
San Luis Obispo, US	5
Claremont, US	5
Riverside, US	5
BClocation not on record	4
Christchurch, NZ	4
Millersville, US	4
University of Stellenboschlocation not on record	4
Adelaide, AU	3
València, ES	3
Canadian Department of Agriculturelocation not on record	3
Mount Annan, AU	3
South Kensington, GB	2
Durban, ZA	2
Jaén, ES	2
Saint Louis, US	2
Brisbane, AU	2
Irvine, US	1
MSB-3054location not on record	1
Tampa, US	1
Kensington, AU	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Xiamen, CN	1
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	1
US	1
South African National Biodiversity Institutelocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Altos de Pipe, VE	1
Universidad de Caldas (UCaldas)location not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	1
San Diego Natural History Museumlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
University of Johannesburglocation not on record	1
Barcelona, ES	1
ASUlocation not on record	1
Santa Barbara, US	1

41 institutions · 145 of 150 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Crassula ovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Ruderal/Coastal Sage Scrub vegetation with E…Naturalized hillside

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 9.40–18.7

Seasonal swing summer↔winter7.50 °C

Max temp (day)18.9 °C 14.7–22.5

Min temp (night)11.7 °C 5.20–14.9

Precipitation63.8 mm/mo 40.7–83.4

Air humidity60.1 % 56.1–63.4

Moisture balance-16.8 mm/mo -28.8–5.30

Vapour deficit695 Pa 499–832

Wind speed3.20 m/s 1.60–3.80

Cloud cover32.0 % 21.0–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crassula ovata

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment14

Physiology & chemistry1

Other traits1

Compound class profile2 classes

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 991 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 41 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 991 records