Crassula muscosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records1 949

Data sources7

Biological traits27

DNA specimens1

eDNA detections2

Sources7 archives

Databases and archives Crassula muscosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 949 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF1 949 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Tetraphyle muscosa là một loài thực vật có hoa trong họ Crassulaceae. Loài này được Eckl. & Zeyh. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length max4 mm

Leaf length min3 mm

Leaf width max2 mm

Plant height max0.8 m

Plant height min0.1 m

Life cycle & reproduction7

Deciduousnessdeciduous

Flower colouryellow

Flowering endMar

Flowering startFeb

Life formsucculent subshrub

Life spanannual

⚠ sources differ — AusTraits: annual · GIFT: perennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: succulent

Leaf formimbricate

Succulenceyes

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous woody_base · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Shoot orientationerect

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula muscosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences6

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSOR392126.1 ↗588 bp

ACGT

TCGCAGCCTTTGAAGCACGACCGTGGACATGTTGTTAAATTGAGGAGTTGAGGGATTCCTTCGGGTTTTCCTTGCCCCTCCATCGACCAA …

Crassula muscosa var. muscosa voucher Zhigila, Schmiedel & Muasya 1135 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type1 949 records

Wild obs. + sensor1 873

Museum / vouchered38

Cultivated / captive1

Other37

Range

Area of Occupancy AOO5 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 145≤1 km 120≤10 km 46>10 km 119

1 430 georeferenced · 443 without coordinates

Open the mapobservation + sensor1 873

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 3≤1 km 6≤10 km 3>10 km 2

14 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence38

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	5
Adelaide, AU	4
Bronx, US	2
Cape Town, ZA	2
Pretoria, ZA	2
València, ES	2
Canadian Department of Agriculturelocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Badajoz, ES	2
Helsinki, FI	2
Auckland, NZ	2
Museo Entomologico de Leonlocation not on record	1
CJBGlocation not on record	1
Hobart, AU	1
Provincia di Livornolocation not on record	1
University of Stellenboschlocation not on record	1
Angwin, US	1
BClocation not on record	1

18 institutions · 34 of 38 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Crassula muscosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crassula muscosa

At a glance

Sources7 archives

Size & morphology5

Life cycle & reproduction7

Diet & foraging1

Habitat & environment12

Physiology & chemistry1

Other traits1

At a glance

Record type1 949 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 949 records