Crassula multicava

Lem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records3 983

Data sources9

Biological traits51

DNA specimens5

eDNA detections4

Sources9 archives

Databases and archives Crassula multicava's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 983 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources51 traits

Occurrence & distributionGBIF3 983 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaTgenome

01Narrative

Crassula multicava is a perennial succulent plant from the family Crassulaceae. It is also known under various common names including the fairy crassula, pitted crassula and London pride.Hutchings, A., Scott, A.H., Lewis, G. & Cunningham, A.B. 1996. Zulu medicinal plants: an inventory. University of Natal Press, Pietermaritzburg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology11

Leaf length30 mm

Leaf length max65 mm

Leaf length min15 mm

Leaf width22.5 mm

⚠ sources differ — AusTraits: 22.5 mm · GIFT: 40 mm

Leaf width max40 mm

Leaf width min15 mm

Petiole length1.25 cm

Plant height0.4 m

Plant height max0.5 m

Plant height min0.2 m

Seed mass0.037 mg

⚠ sources differ — TRY: 0.037 mg · GIFT: 0.01 mg

Life cycle & reproduction18

Deciduousnessevergreen

Dispersal typeunspecialized

Flower colourred

Flower length max6 mm

Flower length min5 mm

Flowering endJun

Flowering startJan

Flowering timennnnnnnnnynn

Life formsucculent subshrub

Life spanperennial

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formchamaephyte

Reproduction asexualpresent

Resprouting capacityresprouts

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment15

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf formnarrow-elliptic

Leaf shapeobovate widely_elliptical

Succulenceyes

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3-CAM

⚠ sources differ — TRY: C3/CAM · GIFT: C3

Other traits5

Inflorescencepanicle

Leaf arrangementopposite

Plant support typefree-standing

Seeds per fruit101-1000

Shoot orientationascending

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula multicava has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences5

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW879416.1 ↗660 bp

ACGT

GTCGCAGCCTTTGCAAGCACGACCGTGGACATGTTGTTAATTGAGGAGTCAAGGGATCCCTAGTGCTTCCCCCCTCCATCGACCGTTGTG …

Crassula multicava subsp. multicava voucher LivCol_1947-52501 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Crassula multicava carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 983 records

Wild obs. + sensor3 751

Museum / vouchered172

Cultivated / captive18

Other42

Origin

Native6

Introduced223

Range

Area of Occupancy AOO6 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 859≤1 km 1 197≤10 km 81>10 km 59

3 196 georeferenced · 555 without coordinates

Open the mapobservation + sensor3 751

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 16≤1 km 22≤10 km 19

57 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence172

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the mapnot free-living18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	40
Christchurch, NZ	25
Mount Annan, AU	13
Hobart, AU	10
BDBClocation not on record	9
Rotorua, NZ	5
Wellington, NZ	5
BClocation not on record	4
Canadian Department of Agriculturelocation not on record	4
Adelaide, AU	4
Claremont, US	3
Canberra, AU	3
Brisbane, AU	3
Kensington, AU	3
San Luis Obispo, US	3
Wlocation not on record	2
Universidad Nacional de Colombia (UNAL)location not on record	2
Pontificia Universidad Javeriana (PUJ)location not on record	2
MAlocation not on record	2
MeiseBGlocation not on record	2
CASlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Tampa, US	1
Moscow State Universitylocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1
Universidad de Caldas (UCaldas)location not on record	1
Zürich, CH	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Alicante, ES	1
Wollongong, AU	1
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	1
Paris, FR	1
BIO-UNIPIlocation not on record	1
Honolulu, US	1
València, ES	1
Istituto Agrario Castelnuovolocation not on record	1
BISHlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Bronx, US	1

41 institutions · 167 of 172 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Crassula multicava was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Coastal sage scrub., Sandy graniticCoastal sage scrub.|Sandy granitic|Phenology…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 14.6–15.4

Seasonal swing summer↔winter11.3 °C

Max temp (day)19.2 °C 18.0–20.5

Min temp (night)10.7 °C 10.4–11.0

Precipitation59.9 mm/mo 49.4–70.4

Air humidity59.1 % 57.7–60.5

Moisture balance-35.5 mm/mo -42.9–-28.0

Vapour deficit728 Pa 653–804

Wind speed2.00 m/s 1.20–2.90

Cloud cover35.9 % 30.6–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crassula multicava

At a glance

Sources9 archives

Size & morphology11

Life cycle & reproduction18

Diet & foraging1

Habitat & environment15

Physiology & chemistry1

Other traits5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 983 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 41 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 983 records