Crassula moschata

G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records963

Data sources10

Biological traits31

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Crassula moschata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility963 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF963 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Crassula moschata, commonly known as the Shore Stonecrop, Musky Stonecrop, or Musky Crassula, is a hairless, mat-forming, succulent, perennial herb. It is widespread on the subantarctic and cool temperate shores of the Southern Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology7

Leaf length max10 mm

Leaf size44.37 mm²

Plant height0.1 m

⚠ sources differ — GIFT: 0.1 m · TRY: 0.033 m

Plant height max0.15 m

Seed length0.594 mm

Seed mass0.043 mg

Seed width0.297 mm

Life cycle & reproduction8

Deciduousnessevergreen

Life formsucculent subshrub

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max100 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

Habitat GIFTCoastal

Mycorrhiza type0.009449299

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)158 mg/g

Specific leaf area (SLA)19.54 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula moschata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF436546.1 ↗635 bp

ACGT

TCGCAACCTTTGCAAGCACAACCGTGGATATGTTGTTAATCAAGGAGCCTTGGGATCTTTTGGATCGCCTTGGCCCTCCATCGACTGATG …

Crassula moschata voucher AK288299 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crassula moschata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidypolyploid inferred

Chromosome records28–322n range30median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · new-zealand

CCDB · new-zealand

2n 321×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type963 records

Wild obs. + sensor598

Museum / vouchered363

Other2

Origin

Native1

Range

Area of Occupancy AOO1 956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 347≤1 km 119≤10 km 14>10 km 17

497 georeferenced · 101 without coordinates

Open the mapobservation + sensor598

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 11≤1 km 40≤10 km 17>10 km 7

75 georeferenced · 288 without coordinates

Open the institutions mapphysical evidence363

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	111
Auckland, NZ	51
Paris, FR	42
Christchurch, NZ	39
Hobart, AU	28
Kew, GB	14
San Isidro, AR	12
AASlocation not on record	10
Canberra, AU	9
Buenos Aires, AR	6
QVMAGlocation not on record	6
Adelaide, AU	4
Museo Entomologico de Leonlocation not on record	3
Olocation not on record	3
Saint Louis, US	3
Rotorua, NZ	3
Edinburgh, GB	3
Castelar, AR	2
University of Montpellierlocation not on record	2
AADClocation not on record	2
Mount Annan, AU	1
Parkville, AU	1
Xiamen, CN	1
Ciudad Autónoma de Buenos Aires, AR	1
Cambridge, US	1
Palmerston North, NZ	1
St. Paul, US	1

27 institutions · 360 of 363 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Crassula moschata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)