Crassula glomerata

P.J.Bergius · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records787

Data sources8

Biological traits30

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Crassula glomerata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility787 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF787 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Crassula glomerata (лат.) — вид растений рода Толстянка (Crassula) семейства Толстянковые (Crassulaceae), естественно произрастающий на территории Капской провинции Южно-Африканской Республики.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Leaf length9 mm

Leaf width2 mm

Plant height0.15 m

Plant height max0.15 m

Plant height min0.04 m

Seed mass0.019 mg

⚠ sources differ — TRY: 0.019 mg · GIFT: 0.02 mg

Seed mass max0.02 mg

Seed mass min0.02 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnyyyyyynn

Life formannual

Life spanannual

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max800 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: succulent

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayCAM

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula glomerata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMH503545.1 ↗690 bp

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGCACCCTTTGCAAGGACGACCCGTGGACATGTTGTTAACTTGGGAGT …

Crassula glomerata voucher Bruyns 13004 (BOL) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crassula glomerata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · Oberlander2016 — Friedrich, 1973

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type787 records

Wild obs. + sensor649

Museum / vouchered138

Origin

Native2

Introduced3

Range

Area of Occupancy AOO1 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 477≤1 km 75≤10 km 12>10 km 4

568 georeferenced · 81 without coordinates

Open the mapobservation + sensor649

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 14≤1 km 3≤10 km 38

55 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	51
Pretoria, ZA	44
Cape Town, ZA	15
MSB-3054location not on record	4
BGPAlocation not on record	3
GHPG$location not on record	2
Philadelphia, US	2
Mount Annan, AU	2
South African National Biodiversity Institutelocation not on record	2
MeiseBGlocation not on record	2
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
Canberra, AU	2
MAlocation not on record	1
Stockholm, SE	1
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
Kew, GB	1
Zürich, CH	1

17 institutions · 136 of 138 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Crassula glomerata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)