Crassula decumbens

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records1 107

Data sources7

Biological traits44

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Crassula decumbens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF1 107 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 64

01Narrative

Crassula decumbens est une espèce de plantes succulentes de la famille des Crassulaceae et du genre des Crassula.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Leaf length5.5 mm

Leaf length max8 mm

Leaf length min3 mm

Leaf mass per area11.64 g/m2

Leaf size9.33 mm²

Leaf width1.25 mm

⚠ sources differ — AusTraits: 1.25 mm · GIFT: 1 mm

Leaf width max2 mm

Leaf width min1 mm

Plant height0.05 m

⚠ sources differ — GIFT: 0.05 m · AusTraits: 0.105 m

Plant height max0.11 m

Plant height min0.025 m

Seed length0.44 mm

⚠ sources differ — AusTraits: 0.44 mm · GIFT: 0.35 mm

Seed length max0.35 mm

Seed length min0.35 mm

Seed mass0.009 mg

Seed width0.139 mm

⚠ sources differ — AusTraits: 0.139 mm · GIFT: 0.15 mm

Seed width max0.15 mm

Seed width min0.15 mm

Life cycle & reproduction10

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Dispersal typeself+wind

⚠ sources differ — AusTraits: anemochory barochory · GIFT: unspecialized

Flowering timennnnnnyyyynn

Life formannual

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproduction asexualpresent

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: succulent

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapenarrowly_lanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayCAM

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula decumbens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKGU046609.1 ↗970 bp

ACGT

ATGGAGGAAATTAAAGAATCTTTGGAACTCAATAAGTTTCGTAAATATGACTTCCTATATCCACTTATTTTTCAGGAGTATATTTATGCA …

Crassula decumbens var. decumbens isolate AM180 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Crassula decumbens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidypolyploid inferred

Chromosome records32–642n range64median64mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 643×CCDB · nw-europe-fl · CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2512

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · Oberlander2016 — Friedrich, 1973

2n 322×CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · Oberlander2016 — Friedrich, 1973

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 107 records

Wild obs. + sensor849

Museum / vouchered253

Cultivated / captive5

Origin

Native36

Introduced10

Range

Area of Occupancy AOO3 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 464≤1 km 67≤10 km 100>10 km 31

662 georeferenced · 187 without coordinates

Open the mapobservation + sensor849

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 47≤1 km 33≤10 km 79>10 km 4

163 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence253

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	60
Auckland, NZ	59
Mount Annan, AU	36
Kensington, AU	33
Christchurch, NZ	15
Museo Entomologico de Leonlocation not on record	7
Wellington, NZ	6
QVMAGlocation not on record	6
Rotorua, NZ	5
Adelaide, AU	4
Brisbane, AU	3
MeiseBGlocation not on record	3
La Trobe Universitylocation not on record	3
Kew, GB	2
BGPAlocation not on record	2
Smithfield, AU	2
Xiamen, CN	1
Hobart, AU	1
Parkville, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1

22 institutions · 252 of 253 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Crassula decumbens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crassula decumbens

At a glance

Sources7 archives

Size & morphology18

Life cycle & reproduction10

Diet & foraging1

Habitat & environment13

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 107 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 107 records