Crassula deceptor

Schönland & Baker fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records300

Data sources10

Biological traits17

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Crassula deceptor's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility300 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF300 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Crassula deceptor is a succulent plant native to South Africa and Namibia. This species occurs from southern Namibia, to as far south as the town of Vanrhynsdorp in South Africa. The leaves of this variable species are produced in four compact ranks, and have hard papillae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.15 m

Plant height min0.07 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max400 m

Elevation min50 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry2

Photosynthetic pathwayCAM

Specific leaf area (SLA)4.53 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula deceptor has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSOR392118.1 ↗589 bp

ACGT

TCGCAGCCTTTGAAGCACGACCCGTGGACAAGTTGTTAACTGGGGAGTCAAGGGGATCACTTGTGCTTCCCTTGGCCCTCTATCGGCCTA …

Crassula deceptor voucher Zhigila, Schmiedel & Muasya 1014 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crassula deceptor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · book-ipcn73-74 · CCDB · book-fedorov

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · book-fedorov — Baldwin 1936b

n 71×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type300 records

Wild obs. + sensor278

Museum / vouchered22

Range

Area of Occupancy AOO924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 131≤1 km 12≤10 km 8>10 km 116

267 georeferenced · 11 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	20
South Kensington, GB	2

2 institutions · 22 of 22 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Crassula deceptor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)