Crassula colligata

Toelken · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records627

Data sources6

Biological traits25

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Crassula colligata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility627 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF627 records

DNA & barcodingNCBIsequences

01Narrative

Crassula colligata is a herb in the family Crassulaceae that is native to Western Australia. The annual herb has an erect habit and typically grows to a height of 16 cm. It is commonly found on cliffs, scarps, in gullies, behind dunes and near salt lakes along the south coast in the Great Southern, Wheatbelt and Goldfields-Esperance regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology5

Leaf length2.75 mm

Leaf width0.65 mm

Plant height0.16 m

Plant height max0.16 m

Seed length0.4 mm

Life cycle & reproduction8

Dispersal typeself+wind

Flowering timennnnnnnyyyyn

Life formannual

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayCAM

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula colligata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEF436549.1 ↗641 bp

ACGT

TCGCAGCCTTTGCAAGCACGACCGTGGACATGTTGTTAAACTGAGGGGTCGAGGGATTCCTTTGGGTTCCCCTTGCCCCTCCATCGACCA …

Crassula colligata voucher AK298030 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type627 records

Wild obs. + sensor494

Museum / vouchered133

Origin

Native427

Range

Area of Occupancy AOO1 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 246≤1 km 205≤10 km 20>10 km 3

474 georeferenced · 20 without coordinates

Open the mapobservation + sensor494

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 11≤1 km 67≤10 km 38>10 km 11

127 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	74
Adelaide, AU	40
Auckland, NZ	7
Museo Entomologico de Leonlocation not on record	6
Christchurch, NZ	3
Stockholm, SE	1
Kensington, AU	1

7 institutions · 132 of 133 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)