Crassicantharus noumeensis

(Crosse, 1870) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Dolicholatiridae/Crassicantharus

At a glance

Occurrence records78

Data sources8

Biological traits2

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Crassicantharus noumeensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS78 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD6 specimens

01Narrative

Crassicantharus noumeensis, common name the gold-banded latirus, is a species of sea snail, a marine gastropod mollusk in the family Dolicholatiridae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassicantharus noumeensis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes4

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACGTTATATATTCTCTTTGGGATATGATCGGGATTGGTTGGAACCGCCCTTAGTTTACTTATTCGTGCAGAACTTGGACAACCTGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tomichia ventricosasame order16.4%Dolicholatirus lanceasame order16.4%Nassarius variciferussame order16.4%Nassa sertasame order17.2%Bembicium flavescenssame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S28SH3

animal barcoderibosomalmarker

08Occurrence & distribution

Record type78 records

Wild obs. + sensor31

Museum / vouchered46

Other1

Range

Area of Occupancy AOO212 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 12.2 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 1≤1 km 16≤10 km 2>10 km 12

31 georeferenced

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 1≤1 km 15≤10 km 3>10 km 3

22 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	9
Sydney, AU	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Museum and Art Gallery of the Northern Territorylocation not on record	3
Paris, FR	2
Denver, US	1
CASlocation not on record	1
USPac-SMSlocation not on record	1

8 institutions · 28 of 46 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Crassicantharus noumeensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 21.1–23.8

Seasonal swing summer↔winter2.50 °C

Max temp (day)24.2 °C 21.7–26.6

Min temp (night)21.1 °C 20.0–22.6

Precipitation312 mm/mo 184–333

Air humidity69.3 % 62.8–69.6

Moisture balance200 mm/mo

Vapour deficit902 Pa 770–1,080

Wind speed6.00 m/s

Cloud cover32.7 % 27.0–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)