Craspedia uniflora

G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Craspedia

At a glance

Occurrence records916

Data sources8

Biological traits21

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Craspedia uniflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility916 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF916 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Craspedia uniflora là một loài thực vật có hoa trong họ Cúc. Loài này được G.Forst. mô tả khoa học đầu tiên năm 1786.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length2 mm

Leaf length max80 mm

Leaf width20 mm

Leaf width max20 mm

Leaf width min20 mm

Plant height0.3 m

Plant height max0.45 m

Seed length1.5 mm

Seed length max1.5 mm

Seed length min1.5 mm

Seed mass0.474 mg

⚠ sources differ — TRY: 0.474 mg · GIFT: 0 mg

Seed mass max0 mg

Seed mass min0 mg

Life cycle & reproduction4

Dispersal typewind

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craspedia uniflora has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEF187682.1 ↗618 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACACACCGGGCAAGTAGGATTGTGCTTCTGCACAATCTTTGTGCCTTTGTCAA …

Craspedia uniflora var. uniflora voucher CHR 516278 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Craspedia uniflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1984. Contributions to a chromosome atlas of the New Zealand flora - 27: Compositae. New Zealand J. Bot. 22: 353–356.

CCDB · ipcn-api-dl — Dawson, M. I. & E. J. Beuzenberg. 2000. Contributions to a chromosome atlas of the New Zealand flora. New Zealand J. Bot. 38: 1–24.

2n -11×CCDB · asterace

CCDB · asterace — Turner 1970 Amer. J. Bot.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type916 records

Wild obs. + sensor578

Museum / vouchered337

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO2 684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 378≤1 km 80≤10 km 68>10 km 16

542 georeferenced · 36 without coordinates

Open the mapobservation + sensor578

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 8≤10 km 12>10 km 3

25 georeferenced · 312 without coordinates

Open the institutions mapphysical evidence337

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	198
Wellington, NZ	53
Palmerston North, NZ	27
Auckland, NZ	11
Canberra, AU	9
Parkville, AU	5
Smithfield, AU	4
Kew, GB	3
Vancouver, CA	2
La Trobe Universitylocation not on record	2
Stockholm, SE	2
Hobart, AU	2
Rotorua, NZ	2
Armidale, AU	2
China Agricultural Universitylocation not on record	2
AASlocation not on record	1
Guangzhou, CN	1
Taipei, TW	1
Claremont, US	1
Museo Entomologico de Leonlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Kensington, AU	1
Riverside, US	1
Flagstaff, US	1
Beijing, CN	1
Edinburgh, GB	1

26 institutions · 335 of 337 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Craspedia uniflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)