Craspedia paludicola

J.Everett & Doust · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Craspedia

At a glance

Occurrence records1 058

Data sources7

Biological traits34

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Craspedia paludicola's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 058 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~2.17 Gbp↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF1 058 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT2.2 Gbp

01Narrative

Craspedia paludicola là một loài thực vật có hoa trong họ Cúc. Loài này được J.Everett & Doust mô tả khoa học đầu tiên năm 1992.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology14

Fruit length1.4 mm

Leaf length275 mm

Leaf length max300 mm

Leaf length min150 mm

Leaf width14 mm

Leaf width max20 mm

Leaf width min8 mm

Plant height0.75 m

Plant height max0.75 m

Seed length1.4 mm

Seed mass0.56 mg

⚠ sources differ — TRY: 0.56 mg · AusTraits: 0.617 mg · GIFT: 0.555 mg

Seed mass max0.61 mg

Seed mass min0.5 mg

Seed width0.4 mm

Life cycle & reproduction7

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_oblanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craspedia paludicola has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSEF187671.1 ↗618 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACACACCGGGCAAATAGTATTGTGCTTCTGCACAATCNTTGTGCCTTTGTCAA …

Craspedia paludicola voucher CHR 489440 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Craspedia paludicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 166 270 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Craspedia paludicola2.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 058 records

Wild obs. + sensor729

Museum / vouchered326

Cultivated / captive2

Other1

Origin

Native54

Range

Area of Occupancy AOO1 684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 521≤1 km 114≤10 km 76

711 georeferenced · 18 without coordinates

Open the mapobservation + sensor729

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 34≤1 km 123≤10 km 138>10 km 6

301 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence326

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	190
Mount Annan, AU	38
Canberra, AU	38
Hobart, AU	26
Adelaide, AU	17
Brisbane, AU	6
Christchurch, NZ	4
Stockholm, SE	2
Kew, GB	2
La Trobe Universitylocation not on record	2
Armidale, AU	1

11 institutions · 326 of 326 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Craspedia paludicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Craspedia paludicola

At a glance

Sources7 archives

Size & morphology14

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Record type1 058 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 11 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 058 records