Craspedia aurantia

J.Everett & J.Thomps. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Craspedia

At a glance

Occurrence records446

Data sources10

Biological traits43

DNA specimens1

eDNA detections2

Sources10 archives

Databases and archives Craspedia aurantia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility446 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF446 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT2.2 Gbp

01Narrative

Craspedia aurantia, is a flowering plant in the family Asteraceae and grows in New South Wales and Victoria. It has light green leaves and heads of yellow to reddish-brown flowers on a single flowering stem.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology18

Fruit length1 mm

Fruit width0.45 mm

Leaf length72.5 mm

Leaf length max200 mm

Leaf length min20 mm

Leaf mass per area42.14 g/m2

Leaf size776 mm²

⚠ sources differ — TRY: 776 mm² · AusTraits: 626 mm²

Leaf width9 mm

Leaf width max30 mm

Leaf width min2 mm

Plant height0.375 m

⚠ sources differ — AusTraits: 0.375 m · TRY: 0.044 m

Plant height max0.8 m

Plant height min0.15 m

Seed length1.65 mm

Seed mass0.461 mg

⚠ sources differ — TRY: 0.461 mg · AusTraits: 0.376 mg · GIFT: 0.44 mg

Seed mass max0.44 mg

Seed mass min0.44 mg

Seed width0.69 mm

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typewind

Flowering timeyynnnnnnnnny

Life span>10

⚠ sources differ — TRY: >10 · AusTraits: perennial

Lifespan years10 years

Pollination syndromeinsect

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate spathulate

Woodinessnon-woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)216 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.98 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craspedia aurantia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSEF187660.1 ↗618 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACACACCGGGCAAATAGGATTGTGCTTCTGCACAATCTTTGTGCCTTTGTCAA …

Craspedia aurantia voucher CHR 487571 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Craspedia aurantia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 193 165 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Craspedia aurantia2.19 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidy2× / 10× cytotypes

Chromosome records22–1102n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Watanabe, K., P. S. Short, T. Denda, N. Konishi, M. Ito & K. Kosuge. 1999. Asteraceae: chromosome numbers and karyotypes in the Australian Gnaphalieae and Plucheeae. Austral. Syst. Bot. 12: 781–802.

2n 221×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

2n 881×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

2n 1101×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type446 records

Wild obs. + sensor212

Museum / vouchered232

Cultivated / captive2

Origin

Native63

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 181≤1 km 13≤10 km 8

202 georeferenced · 10 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 61≤1 km 108≤10 km 35>10 km 3

207 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence232

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	96
Mount Annan, AU	61
Canberra, AU	55
NSW Dept of Planning, Industry and Environmentlocation not on record	8
John T. Waterhouse Herbariumlocation not on record	2
Armidale, AU	2
Christchurch, NZ	2
Stockholm, SE	1
Kew, GB	1
Brisbane, AU	1
Parkville, AU	1
Hobart, AU	1
La Trobe Universitylocation not on record	1

13 institutions · 232 of 232 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Craspedia aurantia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)