Cranichis muscosa

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cranichis

At a glance

Occurrence records424

Data sources7

Biological traits13

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Cranichis muscosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF424 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cranichis muscosa, the cypress-knee helmet orchid, is a species of terrestrial orchid. It is widespread across most of the West Indies, extending into Central America, southern Mexico, Belize, northern South America, and southern Florida.Kew World Checklist of Selected Plant FamiliesFlora of North America v 26 p 547, Cranichis muscosa Swartz, Prodr. 120. 1788.Biota of North America Program, 2013 county distribution mapHammel, B.E. & al. (2003). Manual de Plantas de Costa Rica 3: 1-884. Missouri Botanical Garden Press, St. Louis.Sayers, B. & Du Plooy, H. (2003). Additions to the Orchid Flora of Belize. Lankesteriana 8: 1-3.Harling, G. & Andersson, L. (2005). 225(2). Orchidaceae Genera Aa-Cyrtidiorchis. Flora of Ecuador 76: 1-347. Botanical Institute, University of Göteborg, Riksmuseum, StockholmHokche, O., Berry, P.E. & Huber, O. (eds.) (2008). Nuevo Catálogo de la Flora Vascular de Venezuela: 1-859. Fundación Instituto Botánico de Venezuela.Dueñas Gómez, H.del C. & Fernández Alonso, J.L. (2009). Sinopsis de la subfamilia Spiranthoideae (Orchidaceae) en Colombia, parte II. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales 33: 157-181.Macagnan, T.A., de Camargo Smidt, E. & Oliveira de Azevedo, C. (2011). A subtribo Cranichinae Lindl. (Orchidaceae) no estado do Paraná, Brasil. Revista Brasileira da Botánica 34: 447-461.Acevedo-Rodríguez, P. & Strong, M.T. (2012). Catalogue of seed plants of the West Indies. Smithsonian Contributions to Botany 98: 1-1192.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 090 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cranichis muscosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAM419777.1 ↗698 bpCosta Rica

ACGT

TCGAGACCCAAACAGGATTGGATGACTTCTGATAACTCGTGAATATTTGATAGCGATAGCTGTCTATACACACCATTCATCTGTTGCTCC …

Cranichis muscosa ITS1, 5.8S rRNA gene, ITS2 and 26S rRNA gene (partial), specimen voucher Pupulin 1792, (USJ)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type424 records

Wild obs. + sensor260

Museum / vouchered163

Other1

Origin

Native1

Range

Area of Occupancy AOO764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 31≤1 km 11≤10 km 165>10 km 40

247 georeferenced · 13 without coordinates

Open the mapobservation + sensor260

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 9≤1 km 15≤10 km 20>10 km 1

45 georeferenced · 118 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	43
South Kensington, GB	23
Saint Louis, US	23
St. Augustine, TT	11
Chicago, US	5
Montréal, CA	3
Cambridge, US	3
Station d'Ecologie de Lamtolocation not on record	3
Xiamen, CN	3
Museo Nacional de Costa Rica (MNCR)location not on record	3
Harvard Universitylocation not on record	3
Universidad Nacional de Colombia (UNAL)location not on record	2
Mexico City, MX	2
Fredericksburg, US	2
Ciudad de México, MX	2
Moscow State Universitylocation not on record	2
Toronto, CA	1
Universidad de Caldas (UCaldas)location not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
UFMGlocation not on record	1
Tampa, US	1
Cambridge, US	1
Burlington, US	1
León, NI	1
CASlocation not on record	1
Aarhus, DK	1
San José, CR	1
HUAlocation not on record	1
Quito, EC	1
National Biodiversity Institute, Costa Ricalocation not on record	1

30 institutions · 147 of 163 vouchered records shown · 13 without an institution code

09Environmental DNA3 detections

Where the DNA of Cranichis muscosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 20.6–20.6

Seasonal swing summer↔winter1.70 °C

Max temp (day)24.6 °C

Min temp (night)17.4 °C

Precipitation253 mm/mo

Air humidity71.2 %

Moisture balance125 mm/mo

Vapour deficit699 Pa

Wind speed1.70 m/s

Cloud cover31.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)