Cotoneaster integerrimus
Medik. · speciesAt a glance
Occurrence records33 042
Data sources11
Biological traits135
DNA specimens19
eDNA detections13
Sources11 archives
Databases and archives Cotoneaster integerrimus's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility33 042 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources135 traits
Occurrence & distributionGBIF33 042 records
Environmental DNA1 datasets · 2 countries13 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB2n = 68
01Narrative
Cotoneaster scandinavicus, commonly known as Scandinavian cotoneaster, is a species of Cotoneaster native to Scandinavia, in Norway, Sweden and Finland south of the Arctic Circle, the Danish island of Bornholm, and also the Baltic States of Estonia and Latvia.Den virtuella floran: Cotoneaster scandinavicus (in Swedish) It is a recently described species, closely related to (and formerly considered conspecific with) Cotoneaster integerrimus from central and eastern Europe and southwest Asia, and is also related to Cotoneaster cambricus from Wales. It differs from C. integerrimus in that the leaves are always glabrous above, and the 5 mm diameter fruit are light orange-red, not dark red. It grows up to 2 m (7 ft) tall (though usually much less), and occurs primarily on thin soils over chalk and limestone.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology21
Fruit length6.75 mm
Fruit length max7 mm
Fruit length min6 mm
Fruit width6.1 mm
Fruit width max7 mm
Fruit width min6 mm
Leaf length35 mm
Leaf length max50 mm
Leaf length min20 mm
Leaf mass31.94 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 316 mm² · GIFT: 391 mm²
Leaf width max25 mm
Leaf width min13 mm
Plant height1.57 m
⚠ sources differ — GIFT: 1.57 m · LEDA: 1.15 m · USDA: 2.74 m · TRY: 1.6 m
Plant height generative1.15 m
Plant height max3 m
Plant height min0.5 m
Seed length3.83 mm
Seed mass10.15 mg
⚠ sources differ — TRY: 10.15 mg · LEDA: 9.75 mg · GIFT: 34.74 mg
Seed mass max9.88 mg
Seed mass min8.23 mg
Life cycle & reproduction35
Bloom periodMid Spring
Coppice potentialYes
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flower conspicuousYes
Flowering endJun
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formshrub
Life spanwoody
⚠ sources differ — TRY: woody · LEDA: perennials · GIFT: perennial
Lifespan categoryModerate
Lifespan years15 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityYes
Seed number198
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation mean2 500 m
Elevation min2 500 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourred
Fruit typedrupe
Growth formshrub
Growth form USDAMultiple Stem
Habitat GIFTmountains, stony places
Hedge toleranceMedium
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.00000000985
Root depth min16 in
Shape and orientationSemi-Erect
Small grainNo
Woodinesswoody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min130 days
Leaf dry-matter content (LDMC)385 mg/g
Leaf n21.5 mg/g
Leaf p2.84 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max30 in
Precipitation min14 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max8.7 pH
Soil pH min6.8 pH
Specific leaf area (SLA)18.73 mm²/mg
⚠ sources differ — TRY: 18.73 mm²/mg · LEDA: 11.64 mm²/mg · GIFT: 12.85 mm²/mg
Temperature min-43 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits9
Diaspore typeaggregate fruit (syncarpous)
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr2.74 m
Plant support typefree-standing
Planting density max4 800 per acre
Planting density min1 200 per acre
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cotoneaster integerrimus has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes5
GenBank sequences9
eDNA detections13
Countries4
The DNA barcodea real sequence read deposited for this species
TTGTCGAACCTGCACAGCAGAACGACCCGAGAACCGGTTTCAACGTCGGGGGTCGACGGGCCTTTGGGCTCGGCGTCCCCTTATCCCGGG …
Cotoneaster integerrimus voucher 1234-82A internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL6★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Cotoneaster integerrimus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidypolyploid inferred
Chromosome records34–1022n range68median68mode16records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6813×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +3
CCDB · ipcn-api-dl — Ceschmedziev, I. V. 1983a. In IOPB chromosome number reports LXXX. Taxon 32: 506.
CCDB · ipcn-api-dl — Krügel, T. 1992. Zur zytologischen Struktur der Gattung Cotoneaster (Rosaceae, Maloideae) III. Beitr. Phytotax. 15: 69–86.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — GLADKOVA, V.N. 1968. Karyological studies on the genera Crataegus L. and Cotoneaster Medik. (Maloideae) as related to their taxonomy. (In Russian) Bot. Zurn. 53: 1263-1273.
CCDB · book-indian_vol1 — Moffett, A.A. 1931a
CCDB · eflora
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Cesmedziev, I. (1983a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXX]. Taxon 32(3): 506.
CCDB · CromoCat 2015 — Ceschmedziev, I. V. (1983). In IOPB chromosome number reports LXXX. Taxon 32: 506
CCDB · CromoCat 2015 — Kroon, G. H. (1975). Polyploidy in Cotoneaster II. Acta Bot. Neerl. 24(5-6): 417-420.
CCDB · CromoCat 2015 — Krügel, T. (1992). Zur zytologischen Struktur der Gattung Cotoneaster (Rosaceae, Maloideae) III Beitr. Phytotax. 15:69-86
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
2n 513×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — GLADKOVA, v. N. 1967. Chromosome numbers of some species of Cotoneaster Med. and Crataegus L. (In Russian). Bot. Zhur. 52: 354-356.
CCDB · book-indian_vol1 — Sax, H.J. 1954 ; Gladkova, V.N. (Fedorov)
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 342×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — FAVARGER, c. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.
CCDB · CromoCat 2015 — Favarger, C. (1969c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXII]. Taxon 18(3): 433-442.
2n 1021×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Favarger 1975a
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type33 042 records
Wild obs. + sensor29 024
Museum / vouchered3 019
Cultivated / captive12
Other987
Origin
Native10
Introduced235
Range
Area of Occupancy AOO39 840 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy39% within 1 km
≤100 m 6 583≤1 km 2 791≤10 km 14 225>10 km 227
23 826 georeferenced · 5 198 without coordinates
Open the mapobservation + sensor29 024
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 410≤1 km 689≤10 km 635>10 km 64
1 798 georeferenced · 1 221 without coordinates
Open the institutions mapphysical evidence3 019
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 1≤10 km 1
2 georeferenced · 10 without coordinates
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions68 of 137 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| SLU Artdatabankenlocation not on record | 293 |
| Uniwersytet Wrocławskilocation not on record | 250 |
| Olocation not on record | 247 |
| LDlocation not on record | 187 |
| Trondheim, NO | 178 |
| BFLlocation not on record | 174 |
| Moscow State Universitylocation not on record | 132 |
| MeiseBGlocation not on record | 127 |
| Bergen, NO | 89 |
| BIO-UNIPIlocation not on record | 77 |
| Oskarshamn, SE | 68 |
| KMNlocation not on record | 58 |
| Yangling, CN | 57 |
| GMBAlocation not on record | 55 |
| Salzburg, AT | 49 |
| BDBClocation not on record | 48 |
| Beijing, CN | 47 |
| MAlocation not on record | 45 |
| Barcelona, ES | 44 |
| Zürich, CH | 41 |
| Uppsala, SE | 41 |
| GJOlocation not on record | 32 |
| Bern, CH | 31 |
| València, ES | 30 |
| Tartu, EE | 29 |
| Wlocation not on record | 27 |
| Zürich, CH | 23 |
| Vitoria, ES | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 17 |
| Entomological Society of Latvialocation not on record | 17 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 16 |
| BClocation not on record | 15 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 15 |
| Salamanca, ES | 14 |
| Görlitz, DE | 14 |
| Tallinn, EE | 12 |
| PRClocation not on record | 10 |
| Berlin, DE | 9 |
| Jyväskylä, FI | 9 |
| No collectionlocation not on record | 9 |
| Nanjing, CN | 9 |
| Madrid, ES | 8 |
| Sant Julià de Lòria, AD | 8 |
| Uniwersytet Jagiellońskilocation not on record | 8 |
| BRNUlocation not on record | 7 |
| Frankfurt am Main | 7 |
| Porrentruy, CH | 6 |
| ifplocation not on record | 6 |
| Provincia di Livornolocation not on record | 6 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| SZUlocation not on record | 6 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 5 |
| LfUlocation not on record | 5 |
| Mlocation not on record | 4 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Granada, ES | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Guangzhou, CN | 4 |
| NMBU:MINAlocation not on record | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Namur, BE | 3 |
| Jiangxi College of Educationlocation not on record | 3 |
| Sion, CH | 3 |
| Glarus, CH | 3 |
| Lincoln, US | 3 |
| Bourges, FR | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| GZUlocation not on record | 3 |
| TROMlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Dresden, DE | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Wuzhou, CN | 2 |
| CJBGlocation not on record | 2 |
| Lausanne, CH | 2 |
| H-Hildellocation not on record | 2 |
| Alicante, ES | 2 |
| H-Schuhwlocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Saint Louis, US | 2 |
| H-Wolflocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Chengdu, CN | 2 |
| Seoul, KR | 2 |
| Hobart, AU | 1 |
| Badajoz, ES | 1 |
| UFMSlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Denver, US | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Xining, CN | 1 |
| Yunnan Universitylocation not on record | 1 |
| Philadelphia, US | 1 |
| Columbia, US | 1 |
| Criciúma, BR | 1 |
| Voronezh State Universitylocation not on record | 1 |
| Durham, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Gijón, ES | 1 |
| PrivatHerblocation not on record | 1 |
| Oulu, FI | 1 |
| Tacoma, US | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Jaén, ES | 1 |
| Guilin, CN | 1 |
| Stockholm, SE | 1 |
| nlocation not on record | 1 |
| Mount Annan, AU | 1 |
| FLADlocation not on record | 1 |
| Dhaka, BD | 1 |
| Cambridge, US | 1 |
| OLAlocation not on record | 1 |
| Baroda, IN | 1 |
| Xiamen, CN | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Edinburgh, GB | 1 |
| Monastir, TN | 1 |
| H-AkrKGlocation not on record | 1 |
| Paris, FR | 1 |
| South Kensington, GB | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Vancouver, CA | 1 |
| Bloomington, US | 1 |
| College Park, US | 1 |
| Bronx, US | 1 |
| UNESClocation not on record | 1 |
137 institutions · 2 909 of 3 019 vouchered records shown · 101 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Cotoneaster integerrimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map2 countries0
Grown in Garden of Wales
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.0 °C 14.4–17.5
Seasonal swing summer↔winter22.9 °C
Max temp (day)18.6 °C 18.0–20.0
Min temp (night)12.6 °C 10.2–15.1
Precipitation72.3 mm/mo 62.3–91.7
Air humidity62.0 % 58.6–63.7
Moisture balance-43.2 mm/mo
Vapour deficit678 Pa 648–817
Wind speed3.20 m/s
Cloud cover44.2 % 41.6–48.9
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.