Costus montanus

Maas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Costaceae/Costus

At a glance

Occurrence records185

Data sources7

Biological traits10

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Costus montanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

قسط جبلي هو نوع من النباتات يتبع جنس القسط من الفصيلة القسطية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Costus montanus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU215032.1 ↗619 bp

ACGT

TCGAGACCCTACAAGGAATGACTGCGAATACGTAAACCAAGTGTCACTGTTGGCTTTGGCGGGCAAGGTCCCCTTTGGCCCAGTGGCTTC …

Costus montanus voucher 19726433 (BR) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

08Occurrence & distribution

Record type185 records

Wild obs. + sensor75

Museum / vouchered110

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤1 km 2>10 km 72

74 georeferenced · 1 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 110 records without

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	38
Saint Louis, US	28
Museo Nacional de Costa Rica (MNCR)location not on record	22
San José, CR	6
Chicago, US	3
Kew, GB	2
OTSlocation not on record	2
Bronx, US	1

8 institutions · 102 of 110 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Costus montanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 20.6–20.6

Seasonal swing summer↔winter1.70 °C

Max temp (day)24.6 °C

Min temp (night)17.4 °C

Precipitation253 mm/mo

Air humidity71.2 %

Moisture balance125 mm/mo

Vapour deficit699 Pa

Wind speed1.70 m/s

Cloud cover31.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)