Cosmos bipinnatus
Cav. · speciesAt a glance
Occurrence records50 287
Data sources13
Biological traits50
DNA specimens26
eDNA detections18
Sources13 archives
Databases and archives Cosmos bipinnatus's data was compiled from.
WikipediaWikimedia Foundation16 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility50 287 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Chemical compositionLOTUS · NPASS42 compounds
Occurrence & distributionGBIF50 287 records
Environmental DNA1 datasets · 4 countries18 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2n = 24
01Narrative
Cosmos bipinnatus, commonly called the garden cosmos or Mexican aster, is a medium-sized flowering herbaceous plant in the daisy family Asteraceae, native to the Americas. The species and its varieties and cultivars are popular as ornamental plants in temperate climate gardens.Flora of North America, Cosmos bipinnatus CavanillesFlora of China, 秋英 qiu ying, Cosmos bipinnatus CavanillesAltervista Flora Italiana, Astro messicano, fiederblättriges Schmuckkörbchen, rosenskära, Cosmos bipinnatus Cav.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology12
Fruit length7.5 mm
⚠ sources differ — AusTraits: 7.5 mm · GIFT: 9 mm
Fruit length max18 mm
Fruit length min5 mm
Leaf length90 mm
Leaf length max150 mm
Leaf length min50 mm
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · AusTraits: 1 m · TRY: 1.55 m
Plant height max2.5 m
Plant height min0.4 m
Seed mass7.13 mg
⚠ sources differ — TRY: 7.13 mg · GIFT: 8.67 mg
Seed mass max10.2 mg
Seed mass min5.6 mg
Life cycle & reproduction18
Deciduousnessevergreen
Dehiscenceindehiscent
Flower colourorange
Flower length max35 mm
Flower length min20 mm
Flower width max20 mm
Flower width min12 mm
Flowering endOct
Flowering startJul
Flowering timennnnnnnnyyyn
Life formannual
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual · GIFT: annual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 620 m
Elevation min1 000 m
Epiphyteterrestrial
Fruit colourblack
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formlinear
Leaf shapeovate
Mycorrhiza type0.000000015
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)24.18 mm²/mg
Other traits1
Diaspore typefruit
03Chemical composition42 compounds
Compounds documented for Cosmos bipinnatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Ursane and Taraxastane triterpenoids4
Isocoumarins3
Flavones2
Cyclic peptides $ Depsipeptides $ Lipopeptides2
Tetraketide meroterpenoids2
Documented compounds42 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,12R)-1-methyl-3,13,21,23-tetrazahexacyclo[10.10.2.02,10.04,9.013,22.015,20]tetracosa-2(10),4,6,8,15,17,19,21-octaene-14,24-dione | present | NPASS | |
| (2S,3R)-2,3,4-trimethyl-2,3-dihydro-1-benzofuran-5,7-diol | present | NPASS | |
| (3S,4aR,6aR,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol | present | LOTUS | |
| (3S,6S,9R,12S,19S)-3-benzyl-19-[(2S)-hexan-2-yl]-6-methyl-9-(2-methylpropyl)-12-propan-2-yl-1-oxa-4,7,10,13,16-pentazacyclononadecane-2,5,8,11,14,17-hexone | present | NPASS | |
| (4aR,6aR,6aR,6bR,8aS,12aR,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,6a,7,8,9,12,12a,13,14,14a-tetradecahydro-1H-picen-3-ol | present | LOTUS | |
| 2,6-dihydroxy-4-[(2R,3R)-3-hydroxybutan-2-yl]-3-methylbenzoic acid | present | NPASS | |
| 2,6-Dimethyl-1,3,5,7-Octatetraene | present | LOTUS | |
| 2-[[2-[(3-Pyridinylcarbonyl)amino]benzoyl]amino]-3,4,5-trimethoxybenzoic acid methyl ester | present | NPASS | |
| 24-Methylenecycloartan-3-ol | present | LOTUS | |
| 3'-O-Acetyl-2'-Deoxythymidine | present | NPASS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cosmos bipinnatus has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes5
GenBank sequences10
eDNA detections18
Countries4
The DNA barcodea real sequence read deposited for this species
ACGCATCCCGTCGCCCCACCAACCATCCCGTCTTGGGACTTGTTGGATTGGGGCGGAGATTGGTCTCCCGTGCCCATGGTGCGGCTGGCC …
Cosmos bipinnatus voucher ZX-7043 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Cosmos bipinnatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2418×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +6
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4144
CCDB · ipcn-api-dl — Ohri, D., A. Kumar & M. Pal. 1988. Variation in nuclear DNA and karyotype in Cosmos. Cytologia 53: 365–367.
CCDB · ipcn-api-dl — Banerjee, A. K. 1971. Cytological investigations on some Indian members of the tribe Helianthoideae (Family -- Compositae). J. Cytol. Genet. 6: 90–109.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1984. Karyotype studies in Asteraceae. Cell Chromosome Res. 7: 26–28.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Zhang, Y. x. 1994. Studies on chromosomes of some plants from Guandi Mountain, Shanxi. J. Wuhan Bot. Res. 12(2): 201–206.
CCDB · ipcn-api-dl — Yang, D. k. & J. y. Zhou. 1999. The karyotype analysis of 19 species from Shandong. Guihaia 19(4): 349–354.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1974. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Sugiura, T. 1931, 1936b ; Sharma, A.K. 1947 (Love, A. & Love, D. 1961b); Powell, A.M. & Turner, B.L. 1963; Mehra, P.N. et al. 1965 ; Melchert, T. E. 1968; Mehra, P.N. & Remanandan, P. 1974 ; Keil, D.J. & Stuessy, T.F. . 1977
CCDB · eflora
CCDB · book-atlas-flowering-plants — Sugiura 1936b
CCDB · kew — Ohri D, Kumar A, Pal M. 1988. Variation in nuclear DNA and karyotype in Cosmos. Cytologia 53: 365-367.
CCDB · Cave1956supp — Crowe 1954
n 1211×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Banerjee, A. K. 1971. Cytological investigations on some Indian members of the tribe Helianthoideae (Family -- Compositae). J. Cytol. Genet. 6: 90–109.
CCDB · ipcn-api-dl — Srivastava, V. K. 1986. Induction of colchiploidy in ornamental Cosmos. Proc. Indian Sci. Congr. Assoc. 73(IV–A): 60.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. PINKAVA. 1977. Reinstatement of Carminatia DC. (Compositae: Eupatorieae). Phytologia 35: 323.
CCDB · book-ipcn67-71 — MELCHERT, T.E. 1968. Systematic studies in the Coreopsidinae: Cytotaxonomy of Mexican and Guatemalan Cosmos. Amer. J. Bot. 55: 345-353.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
n 111×CCDB · Cave1963
CCDB · Cave1963 — Powell & T. 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type50 287 records
Wild obs. + sensor47 989
Museum / vouchered2 128
Cultivated / captive5
Other165
Origin
Native2
Introduced360
Range
Area of Occupancy AOO124 352 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 28 721≤1 km 2 418≤10 km 4 930>10 km 488
36 557 georeferenced · 11 432 without coordinates
Open the mapobservation + sensor47 989
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy82% within 1 km
≤100 m 676≤1 km 153≤10 km 161>10 km 18
1 008 georeferenced · 1 120 without coordinates
Open the institutions mapphysical evidence2 128
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 1≤10 km 1
2 georeferenced · 3 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions161 of 262 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 212 |
| Mexico City, MX | 139 |
| Mexico City, MX | 67 |
| Austin, US | 62 |
| Beijing, CN | 61 |
| Kochi, JP | 51 |
| Saint Louis, US | 51 |
| SLU Artdatabankenlocation not on record | 44 |
| Guasave, MX | 42 |
| Görlitz, DE | 41 |
| Chengdu, CN | 38 |
| LDlocation not on record | 37 |
| Philadelphia, US | 37 |
| Odawara, JP | 36 |
| Zacatecas, MX | 35 |
| Chengdu, CN | 32 |
| Bronx, US | 27 |
| Kunming, CN | 27 |
| Olocation not on record | 25 |
| Juriquilla, MX | 24 |
| San Luis Potosí, MX | 24 |
| Tokushima, JP | 22 |
| Nagano City, JP | 20 |
| Provincia di Livornolocation not on record | 20 |
| DBF-NHMDlocation not on record | 19 |
| Moscow State Universitylocation not on record | 19 |
| Christchurch, NZ | 17 |
| Oskarshamn, SE | 17 |
| Mount Annan, AU | 17 |
| QAUlocation not on record | 16 |
| Ciudad de México, MX | 16 |
| Xinxiang, CN | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 13 |
| Tartu, EE | 13 |
| Pretoria, ZA | 12 |
| Puebla, MX | 12 |
| Karlsruhe, DE | 11 |
| MeiseBGlocation not on record | 11 |
| Brisbane, AU | 10 |
| Durban, ZA | 10 |
| Allentown, US | 10 |
| Auckland, NZ | 10 |
| Taipei, TW | 10 |
| Uniwersytet Warszawskilocation not on record | 10 |
| ASUlocation not on record | 10 |
| Salzburg, AT | 10 |
| Nanjing, CN | 9 |
| Universidad de Caldas (UCaldas)location not on record | 9 |
| Guangzhou, CN | 9 |
| San Diego, US | 8 |
| NSMKlocation not on record | 8 |
| Santa Barbara, US | 8 |
| Flagstaff, US | 8 |
| Stockholm, SE | 8 |
| Chongqing Museumlocation not on record | 8 |
| PRClocation not on record | 8 |
| Shinshu Universitylocation not on record | 8 |
| Cape Town, ZA | 7 |
| Philadelphia, US | 7 |
| Québec, CA | 7 |
| University of Stellenboschlocation not on record | 7 |
| Austin, US | 7 |
| Oulu, FI | 7 |
| Córdoba, AR | 7 |
| Riverside, US | 6 |
| Wuhan, CN | 6 |
| Mexico City, MX | 6 |
| Vancouver, CA | 5 |
| BDBClocation not on record | 5 |
| Seoul, KR | 5 |
| Montréal, CA | 5 |
| Tsukuba, JP | 5 |
| BFLlocation not on record | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Chapingo, MX | 5 |
| Barcelona, ES | 5 |
| Canberra, AU | 5 |
| Denver, US | 5 |
| MEXUlocation not on record | 5 |
| Antiguo Cuscatlán, SV | 5 |
| Kew, GB | 5 |
| WNNUlocation not on record | 5 |
| MAlocation not on record | 4 |
| Trondheim, NO | 4 |
| Emporia, US | 4 |
| Wuhan, CN | 4 |
| València, ES | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| WTUlocation not on record | 4 |
| Tampa, US | 4 |
| Berlin, DE | 4 |
| Fukushima Universitylocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Tlalnepantla, MX | 4 |
| Chiba, JP | 4 |
| Bern, CH | 4 |
| Bando, JP | 4 |
| Urumqi, CN | 3 |
| Claremont, US | 3 |
| GJOlocation not on record | 3 |
| Catalina Island Conservancylocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| UChlocation not on record | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Dekalb, US | 3 |
| University of Johannesburglocation not on record | 3 |
| Armidale, AU | 3 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Adelaide, AU | 3 |
| Victoria, CA | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| San Isidro, AR | 3 |
| NMBU:MINAlocation not on record | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 3 |
| Bangkok, TH | 3 |
| Mlocation not on record | 3 |
| KMNlocation not on record | 3 |
| Hobart, AU | 3 |
| Riobamba, EC | 3 |
| Chadron, US | 3 |
| Millersville, US | 3 |
| CJBGlocation not on record | 3 |
| Yaoundé, CM | 3 |
| Bloomington, US | 2 |
| KR | 2 |
| Wellington, NZ | 2 |
| Ensenada, MX | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Western Carolina Universitylocation not on record | 2 |
| Spearfish, US | 2 |
| South Kensington, GB | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| DNSMlocation not on record | 2 |
| Parkville, AU | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Wuzhou, CN | 2 |
| Montecillo, Texcoco, MX | 2 |
| Zapopan, MX | 2 |
| UnBlocation not on record | 2 |
| Anchorage, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Staten Island, US | 2 |
| Sagamihara, JP | 2 |
| Sanda, JP | 2 |
| Changsha, CN | 2 |
| Knoxville, US | 2 |
| ROM020location not on record | 2 |
| H-Dunkellocation not on record | 2 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Mexico City, MX | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Tomioka, JP | 2 |
| H-Hohlalocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Paris, FR | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Chicago, US | 2 |
| Guilin, CN | 2 |
| Fort Worth, US | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Uniwersytet Wrocławskilocation not on record | 2 |
| Albuquerque, US | 1 |
| Madison, US | 1 |
| Université Lavallocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Lincoln, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| TUR-Alocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Irvine, US | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Zhengzhou, CN | 1 |
| Xining, CN | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Mérida, MX | 1 |
| Sendai, JP | 1 |
| KIWElocation not on record | 1 |
| Nijmegen, NL | 1 |
| Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Hidalgolocation not on record | 1 |
| Turku, FI | 1 |
| Puerto Ayora, EC | 1 |
| Castelar, AR | 1 |
| La Paz, BO | 1 |
| Williamsburg, US | 1 |
| KURAlocation not on record | 1 |
| Asheville, US | 1 |
| WAGlocation not on record | 1 |
| Turlock, US | 1 |
| Hermosillo, MX | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Kagoshima, JP | 1 |
| Cambridge, US | 1 |
| Rotorua, NZ | 1 |
| Uppsala, SE | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Corrientes, AR | 1 |
| JMSlocation not on record | 1 |
| Pittsburg, US | 1 |
| Cenargenlocation not on record | 1 |
| Wlocation not on record | 1 |
| San Salvador de Jujuy, AR | 1 |
| Provo, US | 1 |
| UFMGlocation not on record | 1 |
| Northridge, US | 1 |
| BClocation not on record | 1 |
| Elocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Honolulu, US | 1 |
| Pullman, US | 1 |
| Frankfurt am Main | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Dresden, DE | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Shanghai, CN | 1 |
| Guiyang, CN | 1 |
| Linares, MX | 1 |
| BISHlocation not on record | 1 |
| Otaru, JP | 1 |
| JBRJlocation not on record | 1 |
| Portland, US | 1 |
| St. Paul, US | 1 |
| BRNUlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| New Brunswick, US | 1 |
| Kensington, AU | 1 |
| Longwood Universitylocation not on record | 1 |
| Waverly, US | 1 |
| Brasília, BR | 1 |
| Palmerston, AU | 1 |
| EL PASO, US | 1 |
| Ashland, US | 1 |
| Hudson, US | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Corvallis, US | 1 |
| New Haven, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| CASlocation not on record | 1 |
| Brussel, BE | 1 |
| Jinghong, CN | 1 |
262 institutions · 2 035 of 2 128 vouchered records shown · 80 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Cosmos bipinnatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 9.70–20.4
Seasonal swing summer↔winter23.4 °C
Max temp (day)21.8 °C 12.6–25.7
Min temp (night)10.3 °C 7.40–16.1
Precipitation69.1 mm/mo 58.6–98.6
Air humidity57.6 % 53.6–64.3
Moisture balance-52.2 mm/mo -67.9–24.8
Vapour deficit851 Pa 425–1,015
Wind speed2.50 m/s 1.60–3.70
Cloud cover38.8 % 19.9–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.