Coryphaenoides striaturus

Barnard, 1925 · species

image placeholder — illustration coming later

Animalia/Chordata/Gadiformes/Macrouridae/Coryphaenoides

At a glance

Occurrence records931

Data sources7

Biological traits6

DNA specimens24

eDNA detections27

Sources7 archives

Databases and archives Coryphaenoides striaturus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility450 records↗

OBISOcean Biodiversity Information System481 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS931 records

Environmental DNA1 datasets · 3 countries27 detections

DNA & barcodingBOLD24 specimens

01Narrative

Coryphaenoides striaturus is een straalvinnige vissensoort uit de familie van rattenstaarten (Macrouridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1925 door Barnard.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length54 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max1 738 m

Depth min823 m

Vulnerability41.6

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coryphaenoides striaturus has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections27

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

CCTATATCTTGTGTTTGGTGCCTGAGCTGGAATAGTAGGCACTGCCCTAAGTCTTCTCATCCGAGCCGAACTCAGCCAACCTGGCGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair0.31%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coryphaenoides mediterraneussame genus5.7%Coryphaenoides filicaudasame genus11.0%Coryphaenoides carapinussame genus11.2%Coryphaenoides fernandezianussame genus11.3%Coryphaenoides brevibarbissame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type931 records

Wild obs. + sensor433

Museum / vouchered416

Other82

Origin

Native3

Range

Area of Occupancy AOO1 440 km²

Depth

0–200 m sunlit3

200–1000 m twilight55

1–4 km midnight307

>4 km abyssal1

median 1 271.2 m · max 4 017 m · 366 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 328≤1 km 44>10 km 1

373 georeferenced · 60 without coordinates

Open the mapobservation + sensor433

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 46≤1 km 130≤10 km 13>10 km 4

193 georeferenced · 223 without coordinates

Open the institutions mapphysical evidence416

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	98
Museums Victorialocation not on record	20
Sydney, AU	15
CASlocation not on record	14
FishBaselocation not on record	11
South African Institute for Aquatic Biodiversitylocation not on record	7
ICM-CSIClocation not on record	6
Paris, FR	5
Los Angeles, US	3
SCSDlocation not on record	3
Zoologisches Museum Hamburglocation not on record	2
South Kensington, GB	2
CSIRO, Australian National Fish Collectionlocation not on record	1
Washington, US	1

14 institutions · 188 of 416 vouchered records shown · 31 without an institution code

09Environmental DNA27 detections

Where the DNA of Coryphaenoides striaturus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 11.7–22.4

Seasonal swing summer↔winter6.30 °C

Max temp (day)17.2 °C 15.5–22.9

Min temp (night)14.6 °C 8.20–21.8

Precipitation31.8 mm/mo 8.60–95.1

Air humidity59.8 % 58.3–62.6

Vapour deficit700 Pa 566–1,011

Cloud cover31.8 % 22.3–35.7

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)