Corynosoma australe

Johnston, 1937 · species

image placeholder — illustration coming later

Animalia/Acanthocephala/Palaeacanthocephala/Polymorphida/Polymorphidae/Corynosoma

At a glance

Occurrence records15

Data sources6

Biological traits2

DNA specimens50

eDNA detections50

Sources6 archives

Databases and archives Corynosoma australe's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics50 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 5 countries50 detections

DNA & barcodingBOLD50 specimens

01Narrative

Corynosoma autrale is a species of acanthocephalan (also known as thorny-headed worms, or spiny headed worms). This species usually infects pinnipeds; the semi-aquatic fin-footed marine mammals most commonly known as seals and sea lions. Pinniped infections are not exclusive, recently C. australe has been discovered in Magellanic penguins (Spheniscus magellanicus).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonehost

05DNA & barcoding50 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corynosoma australe has left across the world's sequence archives.

At a glance

DNA specimens50

BINs1

Marker genes2

eDNA detections50

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P574 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

61Cvariable

85Gvariable

100Cvariable

139Gvariable

157Avariable

159Tmostly conserved

160Gmostly conserved

186Tmostly conserved

190Avariable

196Amostly conserved

331Tvariable

385Avariable

394Tmostly conserved

406Tmostly conserved

418Gvariable

421Amostly conserved

490Avariable

493Gvariable

539Cvariable

571Cvariable

GTTTGGGTTAAGTATGGTTGTTCGGTTGGAGTTAGGGTCAGGGGGTCAATGGTTGGGGGACGAGTACTTATATAATTTAGTGGTGACTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes16

BIN1

Most divergent pair2.8%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Corynosoma hannaesame genus12.7%Corynosoma strumosumsame genus14.1%Corynosoma villosumsame genus15.0%Corynosoma semermesame genus15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type15 records

Museum / vouchered15

Range

Area of Occupancy AOO32 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	10
Santa Barbara Museum of Natural Historylocation not on record	4
Washington, US	1

3 institutions · 15 of 15 vouchered records shown

09Environmental DNA50 detections

Where the DNA of Corynosoma australe was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 12.5–25.1

Seasonal swing summer↔winter12.8 °C

Max temp (day)19.5 °C 17.2–29.4

Min temp (night)16.0 °C 8.20–22.2

Precipitation25.2 mm/mo 10.3–164

Air humidity57.3 % 51.4–64.0

Moisture balance-38.4 mm/mo

Vapour deficit906 Pa 733–1,134

Wind speed5.80 m/s

Cloud cover28.3 % 19.1–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)