Coryne eximia

Allman, 1859 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Anthoathecata/Corynidae/Coryne

At a glance

Occurrence records1 974

Data sources8

Biological traits6

DNA specimens47

eDNA detections581

Sources8 archives

Databases and archives Coryne eximia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 002 records↗

OBISOcean Biodiversity Information System972 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI581 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 974 records

Environmental DNA3 datasets · 5 countries581 detections

DNA & barcodingBOLD47 specimens

01Narrative

Coryne eximia is a species of athecate hydroid belonging to the family Corynidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length0.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits3

Depth max60 m

Depth min0 m

Vulnerability10

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coryne eximia has left across the world's sequence archives.

At a glance

DNA specimens47

BINs3

Marker genes3

eDNA detections581

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 76% of positions are identical in every specimen.

Where individuals differ — all 156 variable positions, in barcode order

19Cvariable

82Amostly conserved

85Tmostly conserved

97Tmostly conserved

106Cmostly conserved

133Tmostly conserved

139Tmostly conserved

154Tmostly conserved

157Cmostly conserved

163Tmostly conserved

181Gvariable

211Cmostly conserved

220Tmostly conserved

235Cmostly conserved

256Cmostly conserved

262Amostly conserved

266Tmostly conserved

277Cmostly conserved

290Cmostly conserved

295Tmostly conserved

316Cvariable

325Amostly conserved

328Amostly conserved

337Amostly conserved

340Cmostly conserved

346Tmostly conserved

379Tmostly conserved

412Amostly conserved

418Amostly conserved

424Amostly conserved

427Tmostly conserved

433Avariable

451Tmostly conserved

454Tmostly conserved

472Tmostly conserved

473Cmostly conserved

476Gmostly conserved

477Gmostly conserved

478Avariable

479Amostly conserved

480Tmostly conserved

483Cmostly conserved

484Tmostly conserved

486Tmostly conserved

487Gmostly conserved

488Gmostly conserved

489Amostly conserved

490Tmostly conserved

491Amostly conserved

493Amostly conserved

495Tmostly conserved

496Gmostly conserved

497Cmostly conserved

498Cmostly conserved

499Amostly conserved

500Tmostly conserved

501Tmostly conserved

505Tmostly conserved

506Gmostly conserved

508Tmostly conserved

509Tmostly conserved

510Gmostly conserved

511Amostly conserved

513Cmostly conserved

515Gmostly conserved

516Tmostly conserved

517Tmostly conserved

518Tmostly conserved

520Amostly conserved

521Amostly conserved

523Tvariable

525Cmostly conserved

526Amostly conserved

527Gmostly conserved

529Tvariable

531Tmostly conserved

532Amostly conserved

533Tmostly conserved

542Tvariable

546Cmostly conserved

547Tmostly conserved

549Tmostly conserved

550Amostly conserved

551Cmostly conserved

552Cmostly conserved

553Amostly conserved

554Gmostly conserved

555Tmostly conserved

556Tmostly conserved

557Tmostly conserved

559Amostly conserved

560Gmostly conserved

561Cmostly conserved

562Tmostly conserved

564Gmostly conserved

565Avariable

567Cmostly conserved

568Tmostly conserved

569Amostly conserved

570Tmostly conserved

571Amostly conserved

573Cmostly conserved

574Tmostly conserved

576Tmostly conserved

577Gmostly conserved

578Tmostly conserved

580Amostly conserved

583Gvariable

584Amostly conserved

585Cmostly conserved

586Amostly conserved

587Gmostly conserved

588Amostly conserved

589Tmostly conserved

590Amostly conserved

591Gmostly conserved

592Amostly conserved

594Amostly conserved

595Tmostly conserved

596Tmostly conserved

+36 more variable positions not shown

TACTTTATATTTAGTATTCGGTGCTTTCGCTGGAATGGTTGGTACAGCATTAAGTATGTTAATTAGACTTGAATTAGCTGGACCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes18

BINs3

Most divergent pair7.1%

N.AmericaEuropeS.AmericaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Obelia dichotomasame order12.0%Gonothyraea lovenisame order13.1%Cladonema californicumsame order13.2%Cosmetira pilosellasame order13.5%Eudendrium capillaresame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 974 records

Wild obs. + sensor384

Museum / vouchered1 481

Other109

Range

Area of Occupancy AOO1 252 km²

Depth

0–200 m sunlit389

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.3 m · max 100 m · 389 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 280≤1 km 7≤10 km 3

290 georeferenced · 94 without coordinates

Open the mapobservation + sensor384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 47≤1 km 41≤10 km 3>10 km 1

92 georeferenced · 1 389 without coordinates

Open the institutions mapphysical evidence1 481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stanford Universitylocation not on record	83
Santa Barbara Museum of Natural Historylocation not on record	14
Brussels, BE	13
RBINS-Scientific Heritagelocation not on record	11
Sydney, AU	5
DASSHlocation not on record	5
CEFASlocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	4
Earth Sciences New Zealandlocation not on record	3
Brussels, BE	2
South Kensington, GB	2
Citadel Hill, GB	2
PNHSlocation not on record	1
Royal British Columbia Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
fcnym.unlp.edu.arlocation not on record	1
Washington, US	1
University Museum of Bergen, Natural History Collectionslocation not on record	1
NTNU-VMlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Stockholm, SE	1

21 institutions · 157 of 1 481 vouchered records shown · 439 without an institution code

09Environmental DNA581 detections

Where the DNA of Coryne eximia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found581

Studies independent surveys3

Countries5

Verifiable raw sequence linked83

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 581 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.5 °C 8.42–32.1

pH8.04 7.22–8.40

Conductivity49,800 µS/cm 18,000–61,167

Salinity34.8 PSU 10.5–39.7

Dissolved oxygen7.72 mg/L 4.24–10.6

Turbidity0.497 NTU 0.01–11.4

Nitrate0.547 µmol/L 0.1–13.1

Sand62.9 % 29.9–95.8

Depth2.00 m 0–100

Coastal waterPelagicSediment

333 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 9.90–22.2

Seasonal swing summer↔winter6.80 °C

Max temp (day)16.6 °C 12.9–24.0

Min temp (night)12.0 °C 7.00–21.2

Precipitation73.7 mm/mo 35.6–130

Air humidity58.5 % 56.2–63.7

Moisture balance26.1 mm/mo

Vapour deficit690 Pa 464–1,135

Wind speed5.50 m/s

Cloud cover27.2 % 15.8–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 579 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Coryne eximia

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Record type1 974 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 974 records