Corymorpha nutans

M.Sars, 1835 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Anthoathecata/Corymorphidae/Corymorpha

At a glance

Occurrence records2 824

Data sources8

Biological traits4

DNA specimens30

eDNA detections17

Sources8 archives

Databases and archives Corymorpha nutans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 442 records↗

OBISOcean Biodiversity Information System1 382 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 824 records

Environmental DNA3 datasets · 3 countries17 detections

DNA & barcodingBOLD30 specimens

01Narrative

Corymorpha nutans is a hydroid in the family Corymorphidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max85 m

Depth min0 m

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymorpha nutans has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes5

eDNA detections17

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

178Cmostly conserved

199Tmostly conserved

250Cmostly conserved

266Cmostly conserved

271Cmostly conserved

325Gmostly conserved

415Amostly conserved

454Amostly conserved

500Cmostly conserved

556Amostly conserved

565Avariable

628Amostly conserved

640Cmostly conserved

AACTTTATATATAATCTTTGGTATGTTTTCTGGTATGGTAGGCACTGCTTTAAGTATGTTAATTAGATTAGAATTGTCTAGCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes4

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calycella syringasame order17.2%Tubularia indivisasame order17.3%Cyclocanna productasame order17.3%Eudendrium ramosumsame order17.8%Gonothyraea lovenisame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S18S-5P28S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type2 824 records

Wild obs. + sensor757

Museum / vouchered1 817

Other250

Range

Area of Occupancy AOO2 808 km²

Depth

0–200 m sunlit1 066

200–1000 m twilight26

1–4 km midnight2

>4 km abyssal0

median 64.7 m · max 1 470 m · 1 094 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 514≤1 km 27≤10 km 5

546 georeferenced · 211 without coordinates

Open the mapobservation + sensor757

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 23≤1 km 19≤10 km 2>10 km 4

48 georeferenced · 1 769 without coordinates

Open the institutions mapphysical evidence1 817

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	61
730location not on record	21
Brussels, BE	18
Station Biologique de Roscoff (EDMO:521)location not on record	17
Institut Francais pour l'Etude de la Merlocation not on record	17
DASSHlocation not on record	8
486location not on record	6
Brussels, BE	6
Toronto, CA	5
South Kensington, GB	5
Gothenburg, SE	4
RBINS-Scientific Heritagelocation not on record	4
Stockholm, SE	3
Citadel Hill, GB	2
Copenhagen, DK	2
NTNU-VMlocation not on record	1
Norwegian Institute of Marine Researchlocation not on record	1
ARMS-MBONlocation not on record	1
Cambridge, US	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record	1
CASlocation not on record	1
Goteborg Natural History Museumlocation not on record	1
PNHSlocation not on record	1

23 institutions · 187 of 1 817 vouchered records shown · 596 without an institution code

09Environmental DNA17 detections

Where the DNA of Corymorpha nutans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map3 countries0

Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.00 °C 3.40–10.9

Seasonal swing summer↔winter13.4 °C

Max temp (day)7.40 °C 4.70–13.2

Min temp (night)4.40 °C -0.9–7.20

Precipitation80.5 mm/mo 48.4–209

Air humidity62.1 % 60.5–63.3

Moisture balance13.9 mm/mo -25.2–175

Vapour deficit363 Pa 283–507

Wind speed5.00 m/s 2.80–6.50

Cloud cover48.5 % 44.5–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymorpha nutans

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type2 824 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 824 records