Corymbia haematoxylon

(Maiden) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records235

Data sources8

Biological traits36

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Corymbia haematoxylon's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF235 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

flower buds fruit Corymbia haematoxylon, commonly known as mountain marri, is a species of tree that is endemic to the south-west of Western Australia. It has rough, tessellated bark on the trunk and branches, lance-shaped to narrow egg-shaped adult leaves, flower buds in groups of seven, white flowers and urn-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length27 mm

Fruit width16 mm

Leaf length95 mm

Leaf mass442 mg

Leaf mass per area188 g/m2

Leaf size2 391 mm²

Leaf width30 mm

Petiole length1.6 cm

Plant height15 m

Plant height max15 m

Plant height min1.5 m

Seed length11 mm

Seed mass50 mg

⚠ sources differ — TRY: 50 mg · AusTraits: 40.14 mg · GIFT: 36.3 mg

Seed mass max50 mg

Seed mass min22.61 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timenyynnnnnnnnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density745 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia haematoxylon has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF390456.1 ↗621 bp

ACGT

CATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAAAATTCAATGGGGAAGGCCGGCTCCGCTGGCCGTCCCTCGACGCCG …

Corymbia haematoxylon 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type235 records

Wild obs. + sensor72

Museum / vouchered162

Cultivated / captive1

Origin

Native18

Introduced3

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 55≤1 km 12≤10 km 2

69 georeferenced · 3 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 28≤1 km 27≤10 km 69>10 km 8

132 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence162

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	53
Canberra, AU	43
Museo Entomologico de Leonlocation not on record	22
Mount Annan, AU	21
Adelaide, AU	6
BGPAlocation not on record	6
Brisbane, AU	4
Parkville, AU	4
Kew, GB	1
Armidale, AU	1
Canadian Department of Agriculturelocation not on record	1

11 institutions · 162 of 162 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Corymbia haematoxylon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)