Corymbia grandifolia

(R.Br. ex Benth.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records1 813

Data sources7

Biological traits33

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Corymbia grandifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 813 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 813 records

DNA & barcodingNCBIsequences

01Narrative

flower buds Corymbia grandifolia, commonly known as the cabbage gum, large-leaved cabbage gum and the paper-fruited bloodwood, is a species of tree that is endemic to northern Australia. It has smooth bark, egg-shaped to broadly elliptic to lance-shaped adult leaves, flowers buds in groups of three or seven, creamy white flowers and cup-shaped to cylindrical fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length14 mm

Fruit width11 mm

Leaf length135 mm

Leaf size13 061 mm²

Leaf width65 mm

Petiole length1.25 cm

Plant height15 m

Plant height max15 m

Plant height min3 m

Seed length5.5 mm

Seed mass28.57 mg

Seed mass max28.57 mg

Seed mass min28.57 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnyyyynn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapecordate lanceolate ovate widely_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia grandifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT630924.1 ↗551 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACAACGAACCCCGGCGCGGAATG …

Corymbia grandifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 813 records

Wild obs. + sensor1 516

Museum / vouchered236

Other61

Origin

Native45

Range

Area of Occupancy AOO4 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 024≤1 km 2≤10 km 28>10 km 1

1 055 georeferenced · 461 without coordinates

Open the mapobservation + sensor1 516

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 58≤1 km 32≤10 km 72>10 km 47

209 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	89
Mount Annan, AU	40
Canberra, AU	21
Museo Entomologico de Leonlocation not on record	17
Kensington, AU	15
Adelaide, AU	15
Parkville, AU	14
Palmerston, AU	11
BGPAlocation not on record	4
James Cook Townsvillelocation not on record	2
Kew, GB	2
Armidale, AU	2
Smithfield, AU	2
Honolulu, US	1

14 institutions · 235 of 236 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia grandifolia

At a glance

Sources7 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Record type1 813 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 14 geolocated

Record type1 813 records