Corymbia foelscheana

(F.Muell.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records3 080

Data sources8

Biological traits38

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Corymbia foelscheana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 080 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF3 080 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

flowers and leaves Illustration from Eucalyptographia Corymbia foelscheana, commonly known as the broad-leaved bloodwood, fan-leaved bloodwood or smooth-barked bloodwood, is a species of small tree that is endemic to northern Australia. It has thin, rough, tessellated bark on some or all of the trunk, smooth bark above, broadly egg-shaped to broadly lance- shaped adult leaves, flower buds usually in groups of seven, creamy white flowers and urn-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length24 mm

Fruit width18 mm

Leaf length165 mm

Leaf mass per area220 g/m2

Leaf size10 730 mm²

Leaf width135 mm

Petiole length2.5 cm

Plant height10 m

⚠ sources differ — AusTraits: 10 m · TRY: 9.09 m

Plant height max12 m

Plant height min5 m

Seed length12.5 mm

Seed mass27.58 mg

⚠ sources differ — TRY: 27.58 mg · AusTraits: 17.7 mg · GIFT: 28.57 mg

Seed mass max28.57 mg

Seed mass min28.57 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeyyyyyyyyyyyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapedeltate narrowly_ovate orbicular widely_ovate

Woodinesswoody

Physiology & chemistry6

Leaf dry-matter content (LDMC)492 mg/g

Leaf n7.8 mg/g

Leaf p0.37 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.59 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia foelscheana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKT630923.1 ↗655 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAAAATTCAATGGGGG …

Corymbia foelscheana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type3 080 records

Wild obs. + sensor2 563

Museum / vouchered515

Cultivated / captive1

Other1

Origin

Native96

Range

Area of Occupancy AOO6 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 800≤1 km 4≤10 km 25

1 829 georeferenced · 734 without coordinates

Open the mapobservation + sensor2 563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 39≤1 km 160≤10 km 223>10 km 29

451 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence515

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	162
Canberra, AU	160
Mount Annan, AU	78
Brisbane, AU	31
Museo Entomologico de Leonlocation not on record	24
Parkville, AU	18
Kew, GB	15
Adelaide, AU	8
Kensington, AU	5
Canadian Department of Agriculturelocation not on record	5
John T. Waterhouse Herbariumlocation not on record	4
Smithfield, AU	3
Armidale, AU	1
University of Stellenboschlocation not on record	1

14 institutions · 515 of 515 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Corymbia foelscheana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia foelscheana

At a glance

Sources8 archives

Size & morphology14

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry6

At a glance

Record type3 080 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 080 records