Corymbia flavescens

K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records579

Data sources6

Biological traits29

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Corymbia flavescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF579 records

DNA & barcodingNCBIsequences

01Narrative

fruit Corymbia flavescens, commonly known as cabbage ghost gum, bastard ghost gum, scraggy cabbage gum, or wrinkle-leaf ghost gum, is a species of tree that is endemic to northern Australia. It has smooth powdery bark, egg-shaped to lance-shaped adult leaves, flower buds in groups of three, white flowers and variably-shaped fruit. The Jaru peoples know it as warlarri.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Fruit length10 mm

Fruit width9.5 mm

Leaf length70 mm

Leaf mass per area237 g/m2

Leaf size2 572 mm²

Leaf width60 mm

Petiole length1.4 cm

Plant height15 m

Plant height max15 m

Plant height min3 m

Life cycle & reproduction6

Flowering timennnnnnnnnnyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf shapelanceolate ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia flavescens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT630922.1 ↗654 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAGAACTCGATGGGGA …

Corymbia flavescens 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type579 records

Wild obs. + sensor136

Museum / vouchered443

Origin

Native75

Range

Area of Occupancy AOO1 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 100≤1 km 6≤10 km 2>10 km 2

110 georeferenced · 26 without coordinates

Open the mapobservation + sensor136

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 77≤1 km 118≤10 km 177>10 km 11

383 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence443

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	117
Palmerston, AU	100
Kensington, AU	95
Mount Annan, AU	48
Museo Entomologico de Leonlocation not on record	29
Adelaide, AU	21
Brisbane, AU	10
BGPAlocation not on record	9
Parkville, AU	6
Smithfield, AU	5
Kew, GB	1
Canadian Department of Agriculturelocation not on record	1

12 institutions · 442 of 443 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)