Corymbia ficifolia

(F.Muell.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records1 509

Data sources14

Biological traits54

DNA specimens6

eDNA detections6

Sources14 archives

Databases and archives Corymbia ficifolia's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 509 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources54 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF1 509 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GIFT2n = 22

01Narrative

Little wattlebird feeding on a flowering specimen Corymbia ficifolia (syn. Eucalyptus ficifolia, commonly known as the red flowering gum, is a species of small tree that is endemic to the south-west of Western Australia. It has rough, fibrous bark on the trunk and branches, egg-shaped to broadly lance-shape adult leaves, flower buds in groups of seven, bright red, pink or orange flowers and urn-shaped fruit. It has a restricted distribution in the wild but is one of the most commonly planted ornamental eucalypts.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology23

Fruit length27.5 mm

Fruit length max35 mm

Fruit length min20 mm

Fruit width25 mm

Fruit width max30 mm

Fruit width min20 mm

Leaf length130 mm

Leaf length max150 mm

Leaf length min75 mm

Leaf mass492 mg

Leaf mass per area199 g/m2

Leaf size3 072 mm²

Leaf width40 mm

Leaf width max50 mm

Leaf width min30 mm

Petiole length1.5 cm

Plant height10 m

⚠ sources differ — AusTraits: 10 m · TRY: 9 m

Plant height max30 m

Plant height min2 m

Seed length15 mm

Seed mass27.65 mg

⚠ sources differ — TRY: 27.65 mg · AusTraits: 13.76 mg · GIFT: 29.35 mg

Seed mass max39.85 mg

Seed mass min23.81 mg

Life cycle & reproduction13

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeundefined

⚠ sources differ — AusTraits: undefined · GIFT: unspecialized

Flower colourred

Flowering endSep

Flowering startAug

Flowering timeyyyyynnnynnn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproduction asexualabsent

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 600 m

Elevation min2 000 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf formelliptic

Leaf shapenarrowly_ovate ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Inflorescenceumbel

03Chemical composition6 compounds

Compounds documented for Corymbia ficifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins5

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
3-Methylellagic acid	present	LOTUS
Ellagic acid	present	LOTUS
Ficifolidione	present	LOTUS
Hexahydroxydiphenic acid	present	LOTUS
Penta-O-galloyl-beta-D-glucose	present	LOTUS
Tellimagrandin II	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia ficifolia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences8

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF390451.1 ↗621 bp

ACGT

CATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAAAATTCAATGGGGGAAGGCCGGCTCCGCTGGCCGTCCCTCGACGCC …

Corymbia ficifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Corymbia ficifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)

CCDB · book-indian_vol1 — Smith-White, S. 1942

CCDB · book-atlas-flowering-plants

GIFT · GIFT (floras)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 509 records

Wild obs. + sensor1 156

Museum / vouchered346

Cultivated / captive5

Other2

Origin

Native11

Introduced507

Range

Area of Occupancy AOO3 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 745≤1 km 109≤10 km 36>10 km 22

912 georeferenced · 244 without coordinates

Open the mapobservation + sensor1 156

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 24≤1 km 44≤10 km 67>10 km 17

152 georeferenced · 194 without coordinates

Open the institutions mapphysical evidence346

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	159
Canberra, AU	34
Rotorua, NZ	18
Mount Annan, AU	15
Armidale, AU	11
Museo Entomologico de Leonlocation not on record	11
Adelaide, AU	10
Ivano-Frankivsk, UA	10
Canadian Department of Agriculturelocation not on record	8
BGPAlocation not on record	6
Jardín Botanico de Bogotá José Celestino Mutis (JBB)location not on record	5
Parkville, AU	5
Kew, GB	5
Christchurch, NZ	5
Durban, ZA	4
Hobart, AU	4
Pondicherry, IN	4
Honolulu, US	3
Pontificia Universidad Javeriana (PUJ)location not on record	3
Cape Town, ZA	2
Universidad de Caldas (UCaldas)location not on record	2
Northridge, US	2
Catalina Island Conservancylocation not on record	2
CASlocation not on record	1
University of Stellenboschlocation not on record	1
UNESClocation not on record	1
Emporia, US	1
BClocation not on record	1
Bloomington, US	1
Santa Barbara, US	1
Auckland, NZ	1
Wlocation not on record	1
San Luis Obispo, US	1
Barcelona, ES	1
La Paz, BO	1
Pretoria, ZA	1
Universidad de Nariño (UdeNar)location not on record	1
Wellington, NZ	1
Smithfield, AU	1

39 institutions · 344 of 346 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Corymbia ficifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia ficifolia

At a glance

Sources14 archives

Size & morphology23

Life cycle & reproduction13

Diet & foraging1

Habitat & environment14

Physiology & chemistry2

Other traits1

Compound class profile1 class

Documented compounds6 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 509 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 39 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 509 records