Corymbia ferruginea

(Schauer) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records2 359

Data sources9

Biological traits39

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Corymbia ferruginea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 359 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF2 359 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Corymbia ferruginea, commonly known as the rusty bloodwood, is a species of tree that is endemic to northern Australia. It has rough, tessellated bark on the trunk and branches, a crown of sessile juvenile leaves, flower buds in groups of three or seven, pale creamy yellow flowers and urn-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length21.5 mm

Fruit width16.5 mm

Leaf length115 mm

Leaf mass per area170 g/m2

Leaf size3 024 mm²

Leaf width50 mm

Petiole length0.5 cm

Plant height11 m

Plant height max10 m

Plant height min3 m

Seed length12 mm

Seed mass39.64 mg

Seed mass max41.6 mg

Seed mass min41.6 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeyyyyyynnnnny

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapecordate oblong ovate

Woodinesswoody

Physiology & chemistry6

Leaf dry-matter content (LDMC)538 mg/g

Leaf n8.43 mg/g

Leaf p0.432 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.89 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia ferruginea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKT630921.1 ↗651 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAAAATTCGATGGGGA …

Corymbia ferruginea subsp. ferruginea 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 359 records

Wild obs. + sensor2 091

Museum / vouchered268

Origin

Native34

Range

Area of Occupancy AOO6 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 292≤1 km 4≤10 km 10

1 306 georeferenced · 785 without coordinates

Open the mapobservation + sensor2 091

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 23≤1 km 30≤10 km 148>10 km 9

210 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence268

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	143
Museo Entomologico de Leonlocation not on record	24
Canberra, AU	22
Kensington, AU	17
Adelaide, AU	16
Parkville, AU	15
Mount Annan, AU	15
Brisbane, AU	6
Kew, GB	6
University of Stellenboschlocation not on record	2
Armidale, AU	1
BGPAlocation not on record	1

12 institutions · 268 of 268 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Corymbia ferruginea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia ferruginea

At a glance

Sources9 archives

Size & morphology14

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry6

Other traits1

At a glance

Record type2 359 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 359 records