Corymbia eremaea

(D.J.Carr & S.G.M.Carr) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records870

Data sources6

Biological traits37

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Corymbia eremaea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility870 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF870 records

DNA & barcodingNCBIsequences

01Narrative

Corymbia eremaea, commonly known as mallee bloodwood, hill bloodwood and centre range bloodwood, is a small, mallee-like tree that is endemic to central Australia. Indigenous Australians know the plant as muur-muurpa. It has rough, evenly tessellated bark, lance-shaped leaves, oval to pear-shaped flower buds arranged on a branching peduncle and urn-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length13.5 mm

Fruit width12 mm

Leaf length82.5 mm

Leaf mass209 mg

Leaf mass per area201 g/m2

Leaf size1 048 mm²

Leaf width10 mm

Petiole length1.15 cm

Plant height10 m

Plant height max12 m

Plant height min6 m

Seed length9.5 mm

Seed mass15.27 mg

⚠ sources differ — TRY: 15.27 mg · AusTraits: 7.98 mg · GIFT: 15.13 mg

Seed mass max16.39 mg

Seed mass min13.88 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timeynyynnnnnnyy

Life formtree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_lanceolate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia eremaea has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKT630918.1 ↗618 bp

ACGT

CATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAAAATTCGATGGGGAAGGCCGGCTCCGCTGGCCGTCCCTCGACGCCG …

Corymbia eremaea subsp. eremaea 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type870 records

Wild obs. + sensor257

Museum / vouchered609

Cultivated / captive4

Origin

Native187

Range

Area of Occupancy AOO1 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 65≤1 km 15≤10 km 1

81 georeferenced · 176 without coordinates

Open the mapobservation + sensor257

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 87≤1 km 213≤10 km 242>10 km 47

589 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence609

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	169
Canberra, AU	144
Palmerston, AU	112
Mount Annan, AU	69
Museo Entomologico de Leonlocation not on record	34
Kensington, AU	33
Brisbane, AU	12
Parkville, AU	4
Hobart, AU	2
Canadian Department of Agriculturelocation not on record	2

10 institutions · 581 of 609 vouchered records shown · 28 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)