Corymbia dichromophloia

(F.Muell.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records4 128

Data sources10

Biological traits37

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Corymbia dichromophloia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF4 128 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Corymbia dichromophloia, commonly known as the small-fruited bloodwood, variably-barked bloodwood or gum-topped bloodwood, is a species of tree that is endemic to northern Australia. It has smooth white bark sometimes with flaky bark on the trunk, lance-shaped adult leaves, flower buds usually in groups of seven, creamy white flowers and urn-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length11.5 mm

Fruit width11 mm

Leaf length115 mm

Leaf mass per area247 g/m2

Leaf size1 460 mm²

Leaf width18.5 mm

Petiole length1.65 cm

Plant height10 m

Plant height max12 m

Plant height min4 m

Seed length7 mm

Seed mass18.87 mg

⚠ sources differ — TRY: 18.87 mg · AusTraits: 5.1 mg · GIFT: 12.8 mg

Seed mass max22.22 mg

Seed mass min5.1 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timennyynnnnnnnn

Life formtree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapefalcate lanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density895 mg/cm³

03Chemical composition2 compounds

Compounds documented for Corymbia dichromophloia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavan-3-ols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(-)-Afzelechin		present	LOTUS
(-)-Epiafzelechin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia dichromophloia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSKT630916.1 ↗636 bp

ACGT

CAAGGTTTCCATAGGTGAACTTGCAGAAGGATCATTGTCGAATCCTGCCCAGCAGAACGACTAGAGAATCGGTAAAAAACTCAATGGGGA …

Corymbia dichromophloia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type4 128 records

Wild obs. + sensor2 912

Museum / vouchered1 128

Cultivated / captive5

Other83

Origin

Native316

Range

Area of Occupancy AOO9 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 758≤1 km 13≤10 km 53>10 km 2

1 826 georeferenced · 1 086 without coordinates

Open the mapobservation + sensor2 912

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 215≤1 km 327≤10 km 399>10 km 55

996 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence1 128

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	311
Palmerston, AU	292
Mount Annan, AU	199
Brisbane, AU	107
Museo Entomologico de Leonlocation not on record	71
Kensington, AU	59
Adelaide, AU	35
Parkville, AU	20
Smithfield, AU	10
Armidale, AU	7
John T. Waterhouse Herbariumlocation not on record	4
Kew, GB	4
Canadian Department of Agriculturelocation not on record	4
BGPAlocation not on record	2
James Cook Townsvillelocation not on record	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1

17 institutions · 1 128 of 1 128 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Corymbia dichromophloia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia dichromophloia

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Compound class profile1 class

Documented compounds2 total

At a glance

Record type4 128 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 128 records