Corymbia dallachiana

(Benth.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records1 703

Data sources9

Biological traits31

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Corymbia dallachiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 703 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF1 703 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

flower buds and flowers Corymbia dallachiana commonly known as Dallachy's ghost gum or Dallachy's gum, is a species of tree that is endemic to Queensland. It has smooth bark, lance-shaped or curved adult leaves, flower buds usually in groups of three, white flowers and cup-shaped, cylindrical or barrel-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length11 mm

Fruit width8.5 mm

Leaf length180 mm

Leaf width34 mm

Plant height15 m

Seed mass4.55 mg

Seed mass max4.55 mg

Seed mass min4.55 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timenyyyyyyynnyy

Life formtree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf shapefalcate lanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density748 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Corymbia dallachiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple cyclic polyketides2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
4-Hexanoyl-5-hydroxy-2,2,6,6-tetramethyl-cyclohex-4-ene-1,3-dione		present	LOTUS
6-Hexanoyl-2,2,4,4-tetramethylcyclohexane-1,3,5-trione		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia dallachiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMW139150.1 ↗308 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCC …

Corymbia dallachiana isolate Cor-dal-B-seq1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8

plant barcodefungal barcode

08Occurrence & distribution

Record type1 703 records

Wild obs. + sensor669

Museum / vouchered511

Other523

Origin

Native98

Range

Area of Occupancy AOO5 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 452≤1 km 21≤10 km 2>10 km 6

481 georeferenced · 188 without coordinates

Open the mapobservation + sensor669

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 151≤1 km 113≤10 km 179>10 km 41

484 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence511

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	178
Canberra, AU	115
Mount Annan, AU	96
Smithfield, AU	51
Museo Entomologico de Leonlocation not on record	37
Palmerston, AU	13
James Cook Townsvillelocation not on record	5
Kew, GB	4
Armidale, AU	4
Adelaide, AU	2
Beijing, CN	1
Kensington, AU	1
Parkville, AU	1

13 institutions · 508 of 511 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Corymbia dallachiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia dallachiana

At a glance

Sources9 archives

Size & morphology8

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

Other traits1

Compound class profile1 class

Documented compounds2 total

At a glance

Record type1 703 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 703 records