Corymbia clarksoniana

(D.J.Carr & S.G.M.Carr) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records3 671

Data sources7

Biological traits40

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Corymbia clarksoniana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 671 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF3 671 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Corymbia clarskoniana flowers Corymbia clarksoniana capsules and foliage Corymbia clarksoniana, commonly known as Clarkson's bloodwood or the grey bloodwood, is a species of medium-sized tree that is native to Queensland and northern New South Wales. It has rough, tessellated greyish to brownish bark on the trunk and branches, lance-shaped, glossy green leaves that are paler on the lower surface, flower buds in groups of seven, white flowers and urn-shaped to barrel-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit length22.5 mm

Fruit width12.5 mm

Leaf length102 mm

Leaf length max180 mm

Leaf length min70 mm

Leaf mass per area150 g/m2

Leaf width21 mm

Leaf width max25 mm

Leaf width min8 mm

Petiole length1.6 cm

Plant height25 m

⚠ sources differ — GIFT: 25 m · AusTraits: 15 m · TRY: 3.9 m

Plant height max25 m

Seed length10 mm

Seed mass7.66 mg

Seed mass max7.68 mg

Seed mass min7.68 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeynnnnyyyyyyy

Life formtree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.75 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia clarksoniana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW139071.1 ↗308 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCC …

Corymbia clarksoniana isolate Cor-cla-b1-seq2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type3 671 records

Wild obs. + sensor696

Museum / vouchered1 573

Cultivated / captive8

Other1 394

Origin

Native283

Range

Area of Occupancy AOO8 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 446≤1 km 15≤10 km 4>10 km 8

473 georeferenced · 223 without coordinates

Open the mapobservation + sensor696

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 211≤1 km 372≤10 km 842>10 km 90

1 515 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence1 573

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 6

7 georeferenced · 1 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	454
Canberra, AU	392
Mount Annan, AU	275
Smithfield, AU	258
Museo Entomologico de Leonlocation not on record	87
Palmerston, AU	34
Adelaide, AU	21
Armidale, AU	18
James Cook Townsvillelocation not on record	9
Kew, GB	6
Parkville, AU	4
Kensington, AU	3
Honolulu, US	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Hobart, AU	1
IPA/SPlocation not on record	1
Auckland, NZ	1
Canadian Department of Agriculturelocation not on record	1

18 institutions · 1 568 of 1 573 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Corymbia clarksoniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia clarksoniana

At a glance

Sources7 archives

Size & morphology16

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

Other traits1

At a glance

Record type3 671 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 671 records