Corymbia chippendalei

(D.J.Carr & S.G.M.Carr) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records286

Data sources8

Biological traits37

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Corymbia chippendalei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF286 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Corymbia chippendalei, commonly known as the sand-dune bloodwood or sandhill bloodwood, is a species of small tree or a mallee that is endemic to desert country in central Australia. It has rough bark on part or all of the trunk, lance-shaped adult leaves, flower buds in groups of seven, white flowers and shortened spherical fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length23 mm

Fruit width19.5 mm

Leaf length80 mm

Leaf mass280 mg

Leaf mass per area330 g/m2

Leaf size873 mm²

Leaf width15 mm

Petiole length1.55 cm

Plant height9 m

Plant height max8 m

Plant height min2 m

Seed length11 mm

Seed mass14.05 mg

⚠ sources differ — TRY: 14.05 mg · AusTraits: 12.23 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timeynnnnnnnnnnn

Life formtree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density846 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia chippendalei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKT630911.1 ↗646 bp

ACGT

TCCGTAGGGTGAACCTGCGGAAGGATCATTGTCGATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAAAATTCGATGGAGAAGGCCGG …

Corymbia chippendalei 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type286 records

Wild obs. + sensor55

Museum / vouchered229

Cultivated / captive2

Origin

Native53

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 23≤1 km 2>10 km 3

28 georeferenced · 27 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 55≤1 km 54≤10 km 93>10 km 11

213 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence229

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	62
Canberra, AU	54
Kensington, AU	52
Mount Annan, AU	21
Adelaide, AU	18
Museo Entomologico de Leonlocation not on record	14
BGPAlocation not on record	3
Brisbane, AU	2
Kew, GB	2
Hobart, AU	1

10 institutions · 229 of 229 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Corymbia chippendalei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)