Corymbia bleeseri

(Blakely) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records2 733

Data sources10

Biological traits43

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Corymbia bleeseri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 733 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF2 733 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

bark Corymbia bleeseri, commonly known as the glossy-leaved bloodwood or the smooth-stemmed bloodwood, is a species of tree that is endemic to northern Australia. It has thin, rough bark on part or all of the trunk, smooth bark above, lance-shaped to curved adult leaves, flower buds in groups of seven, creamy white flowers and barrel-shaped fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length18.5 mm

Fruit width12.5 mm

Leaf length140 mm

Leaf mass309 mg

Leaf mass per area190 g/m2

Leaf size1 479 mm²

Leaf width25 mm

Petiole length1.5 cm

Plant height15 m

⚠ sources differ — AusTraits: 15 m · TRY: 12.71 m

Plant height max15 m

Plant height min8 m

Seed length10 mm

Seed mass28.57 mg

⚠ sources differ — TRY: 28.57 mg · AusTraits: 8.71 mg · GIFT: 28.57 mg

Seed mass max28.57 mg

Seed mass min28.57 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnynnnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapefalcate lanceolate

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry8

Leaf c495 mg/g

Leaf dry-matter content (LDMC)446 mg/g

Leaf n8.61 mg/g

Leaf p0.463 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.14 mm²/mg

Wood density760 mg/cm³

03Chemical composition2 compounds

Compounds documented for Corymbia bleeseri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavan-3-ols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(-)-Afzelechin		present	LOTUS
(-)-Epiafzelechin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia bleeseri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ993131.1 ↗542 bp

ACGT

CCGGTAAAAAATTCGATGGGGACGGCCGGCTCCGCTGGCCGTCCCTCGACGCCGGGGATCGCGCGGGCGCCCTCTGGGCGGGCGAGCCCT …

Corymbia bleeseri isolate 14 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 733 records

Wild obs. + sensor2 254

Museum / vouchered478

Other1

Origin

Native83

Range

Area of Occupancy AOO5 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 041≤1 km 2≤10 km 18

1 061 georeferenced · 1 193 without coordinates

Open the mapobservation + sensor2 254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 41≤1 km 117≤10 km 236>10 km 34

428 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence478

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	137
Palmerston, AU	102
Mount Annan, AU	64
Museo Entomologico de Leonlocation not on record	51
Brisbane, AU	46
Kensington, AU	37
Adelaide, AU	13
Parkville, AU	7
Kew, GB	6
John T. Waterhouse Herbariumlocation not on record	5
Canadian Department of Agriculturelocation not on record	5
Armidale, AU	3
AUAlocation not on record	1
University of Stellenboschlocation not on record	1

14 institutions · 478 of 478 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Corymbia bleeseri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia bleeseri

At a glance

Sources10 archives

Size & morphology15

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry8

Compound class profile1 class

Documented compounds2 total

At a glance

Record type2 733 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 733 records