Corymbia aspera

(F.Muell.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records751

Data sources6

Biological traits26

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Corymbia aspera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility751 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF751 records

DNA & barcodingNCBIsequences

01Narrative

Corymbia aspera, commonly known as the rough-leaved ghost gum, rough leaf range gum, desert bloodwood, Brittle Range gum in Western Australia, or snappy gum in the Northern Territory is a species of tree that is endemic to northern Australia. It has smooth white bark, sometimes with a short stocking of rough bark near the base, a crown of sessile juvenile, heart-shaped or egg-shaped leaves, flower buds in groups of seven, creamy white flowers and cup-shaped, barrel-shaped or cylindrical fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length6.5 mm

Fruit width5.5 mm

Leaf length62.5 mm

Leaf width25 mm

Plant height12.5 m

Plant height max10 m

Plant height min4 m

Life cycle & reproduction6

Flowering timennnnnnnnnyyn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapecordate elliptical ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia aspera has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMW139200.1 ↗308 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCC …

Corymbia aspera isolate Cor-asp-seq1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type751 records

Wild obs. + sensor288

Museum / vouchered437

Other26

Origin

Native60

Range

Area of Occupancy AOO1 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 161≤1 km 3≤10 km 8

172 georeferenced · 116 without coordinates

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 69≤1 km 118≤10 km 167>10 km 32

386 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	109
Canberra, AU	87
Brisbane, AU	54
Mount Annan, AU	46
Museo Entomologico de Leonlocation not on record	45
Kensington, AU	45
Adelaide, AU	23
BGPAlocation not on record	6
Smithfield, AU	6
Parkville, AU	5
Kew, GB	4
James Cook Townsvillelocation not on record	2
Hobart, AU	1
Saint Louis, US	1
LDlocation not on record	1
Armidale, AU	1
Canadian Department of Agriculturelocation not on record	1

17 institutions · 437 of 437 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)