Corymbia aparrerinja

K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records1 454

Data sources8

Biological traits35

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Corymbia aparrerinja's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF1 454 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Ghost gum in Palm Valley Corymbia aparrerinja, commonly known as ghost gum, is a species of tree that is endemic to Central Australia. It has smooth bark, lance-shaped or curved adult leaves, flower buds in groups of three or seven, white flowers and cup-shaped to cylindrical fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length11 mm

Fruit width8 mm

Leaf length102 mm

Leaf mass339 mg

Leaf mass per area231 g/m2

Leaf size1 380 mm²

Leaf width26 mm

Petiole length1.25 cm

Plant height20 m

Plant height max20 m

Seed length5 mm

Seed mass4.51 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timeyynnnnynnnny

Life formtree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: savanna

Leaf shapefalcate lanceolate

Woodinesswoody

Physiology & chemistry4

Leaf n8.24 mg/g

Leaf p0.72 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)4 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia aparrerinja has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF390459.1 ↗621 bp

ACGT

CATTGTCGAATCCTGCCCAGCAGAACGACCAGAGAACCGGTAAAGAACTCGATGGGGACGGCGAGCTCCGCTGGCCGTCCCTCGATGCCG …

Corymbia aparrerinja 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 454 records

Wild obs. + sensor866

Museum / vouchered471

Cultivated / captive5

Other112

Origin

Native94

Range

Area of Occupancy AOO3 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 382≤1 km 39≤10 km 9>10 km 12

442 georeferenced · 424 without coordinates

Open the mapobservation + sensor866

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 73≤1 km 127≤10 km 192>10 km 53

445 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence471

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	118
Canberra, AU	107
Brisbane, AU	84
Mount Annan, AU	57
Adelaide, AU	44
Museo Entomologico de Leonlocation not on record	26
Kensington, AU	13
Parkville, AU	8
Smithfield, AU	4
James Cook Townsvillelocation not on record	3
Armidale, AU	3
Kew, GB	2
Canadian Department of Agriculturelocation not on record	1

13 institutions · 470 of 471 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Corymbia aparrerinja was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corymbia aparrerinja

At a glance

Sources8 archives

Size & morphology12

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

At a glance

Record type1 454 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 454 records