Corymbia abergiana

(F.Muell.) K.D.Hill & L.A.S.Johnson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Corymbia

At a glance

Occurrence records368

Data sources8

Biological traits31

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Corymbia abergiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility368 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF368 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Corymbia abergiana, commonly known as range bloodwood or Rockingham Bay bloodwood, is a species of tree that is endemic to Queensland. It has rough bark on the trunk and larger branches, smooth bark on the smaller branches, lance-shaped adult leaves, flower buds in groups of seven, creamy white flowers and barrel-shaped fruit with a very thick rim.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length25.5 mm

Fruit width21.5 mm

Leaf length120 mm

Leaf width37.5 mm

Petiole length2.5 cm

Plant height12 m

Seed length9 mm

Seed mass12.02 mg

⚠ sources differ — TRY: 12.02 mg · AusTraits: 11.4 mg · GIFT: 12.22 mg

Seed mass max12.22 mg

Seed mass min12.22 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnnyynnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density771 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corymbia abergiana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ993145.1 ↗520 bp

ACGT

CCGGTATAAAACTCAATGGGGACAGCGAGCTTCACTGGCCGTCCGTCGATGCTAGGGATCGCGTGGGTGCCCAAAGCGCTTAGGCCCTCC …

Corymbia abergiana isolate 28 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type368 records

Wild obs. + sensor50

Museum / vouchered265

Cultivated / captive3

Other50

Origin

Native33

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 13≤1 km 3≤10 km 5

21 georeferenced · 29 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 56≤1 km 56≤10 km 111>10 km 17

240 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence265

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	74
Smithfield, AU	55
Canberra, AU	52
Mount Annan, AU	31
Museo Entomologico de Leonlocation not on record	16
Kew, GB	7
Armidale, AU	7
Palmerston, AU	6
Adelaide, AU	6
Parkville, AU	5
Kensington, AU	3
Hobart, AU	1
James Cook Townsvillelocation not on record	1

13 institutions · 264 of 265 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Corymbia abergiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)