Corylopsis spicata

Siebold & Zucc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Hamamelidaceae/Corylopsis

At a glance

Occurrence records151

Data sources10

Biological traits6

DNA specimens6

eDNA detections6

Sources10 archives

Databases and archives Corylopsis spicata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF151 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 72

01Narrative

Corylopsis spicata is een plant uit het geslacht schijnhazelaar (Corylopsis) van de toverhazelaarfamilie (Hamamelidaceae). Deze schijnhazelaar werd als eerste uit Japan in Europa geïntroduceerd door Philipp Franz von Siebold. Kenmerkend zijn de vrij grote schutbladen rond de lichtgeurende, lichtgele bloemen die nog lang na de bloei aan de takken blijven zitten en de zigzagvorm van de takken, als bij de haagbeuk. De struik groeit meer open dan de andere en zal ongeveer twee meter hoog en breed worden.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Corylopsis spicata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Cinnamic acids and derivatives4

Oleanane triterpenoids3

Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2,6b,9,9,12a-pentamethyl-4a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-6a-carboxylic acid	present	NPASS
(2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14bS)-2,6b,9,9,12a-pentamethyl-4a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-10-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-6a-carboxylic acid	present	NPASS
1,5-O-Trans-Dicaffeoylquinic Acid	present	NPASS
3,4-Dicaffeoylquinic acid	present	NPASS
4,5-Di-O-caffeoylquinic acid	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (4aS,6aR,6bR,8aR,10S,12aR,14bS)-2,2,6b,9,9,12a-hexamethyl-10-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-3,4,5,6,6a,7,8,8a,10,11,12,13,14,14b-tetradecahydro-1H-picene-4a-carboxylate	present	NPASS
[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (4aS,6aR,6bR,8aR,10S,12aR,14bS)-2,2,6b,9,9,12a-hexamethyl-10-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-3,4,5,6,6a,7,8,8a,10,11,12,13,14,14b-tetradecahydro-1H-picene-4a-carboxylate	present	NPASS
butyl (1S,3R,4R,5R)-3,4-bis[[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy]-1,5-dihydroxycyclohexane-1-carboxylate	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corylopsis spicata has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF456716.1 ↗669 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTAAAAAATACAATTGGGGGCGGGGGGGCATTCGTGCTCCTCTCACCCCCAAAATC …

Corylopsis spicata isolate 15781AC clone A internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Corylopsis spicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome records72–722n range72median72mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 724×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Oginuma, K. 1991. Karyomorphology of Corylopsis spicata (Hamamelidaceae; Hamamelidoideae). Acta Phytotax. Geobot. 42: 19–22.

CCDB · book-fedorov — Anderson E., Sax 1935

CCDB · book-fedorov — Santamour 1965a

CCDB · book-atlas-flowering-plants

n 361×CCDB · book-ipcn65

CCDB · book-ipcn65 — Santamour 1965a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type151 records

Wild obs. + sensor25

Museum / vouchered124

Cultivated / captive1

Fossil1

Range

Area of Occupancy AOO288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 4≤1 km 12≤10 km 6

22 georeferenced · 3 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 10≤1 km 36≤10 km 34>10 km 1

81 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence124

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	27
Philadelphia, US	16
Durham, US	10
MeiseBGlocation not on record	8
South Kensington, GB	6
FFPRIlocation not on record	6
Chongqing Museumlocation not on record	6
Bronx, US	5
Bangkok, TH	4
Auckland, NZ	4
Royal Botanical Gardenslocation not on record	3
Sanda, JP	3
KIRMlocation not on record	3
Clemson, US	2
South China Normal Universitylocation not on record	2
College Park, US	2
Washington, US	1
Kagoshima, JP	1
Knoxville, US	1
University of Stellenboschlocation not on record	1
Tampa, US	1
Logan, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Columbia, US	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Awka, NG	1
Vitoria, ES	1

27 institutions · 118 of 124 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Corylopsis spicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)