Corylopsis pauciflora

Siebold & Zucc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Hamamelidaceae/Corylopsis

At a glance

Occurrence records285

Data sources11

Biological traits11

DNA specimens12

eDNA detections12

Sources11 archives

Databases and archives Corylopsis pauciflora's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF285 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Corylopsis pauciflora, the buttercup witch hazel or winter hazel, is a species of flowering plant in the genus Corylopsis of the family Hamamelidaceae, native to Taiwan and Japan. It is a deciduous, spreading shrub growing to 1.5 m tall by 2.5 m wide. It produces masses of pale yellow flowers in pendent racemes in early spring, followed by leaves opening bronze and turning to rich green. It is cultivated in gardens and parks in temperate regions. The Latin specific epithet pauciflora means "with few flowers". This refers to the low number of flowers per inflorescence compared to other Corylopsis, not to the total number of flowers per plant. This plant has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length7 mm

Fruit length max8 mm

Fruit length min6 mm

Plant height3 m

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corylopsis pauciflora has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes3

GenBank sequences10

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAB299335.1 ↗506 bp

ACGT

CTCCTCTCACCCCCAAATCGAGACGCGCTCGGTGCTCGATCAGCAACGCGTGCCTCGCGCACGGGAAGCTTCGGTGCCGCGTGCTCTCGA …

Corylopsis pauciflora genes for ITS1, 5.8S rRNA, ITS2, partial and complete sequence, type 19

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Corylopsis pauciflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Oginuma, K. & H. Tobe. 1991. Karyomorphology and evolution in some Hamamelidaceae and Platanaceae (Hamamelididae; Hamamelidales). Bot. Mag. (Tokyo) 104: 115–135.

CCDB · book-atlas-flowering-plants — Anderson & S. 1935

n 121×CCDB · book-ipcn65

CCDB · book-ipcn65 — Santamour 1965a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type285 records

Wild obs. + sensor73

Museum / vouchered209

Cultivated / captive3

Origin

Native4

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 5≤1 km 26>10 km 36

67 georeferenced · 6 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 4≤1 km 21≤10 km 8>10 km 1

34 georeferenced · 175 without coordinates

Open the institutions mapphysical evidence209

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kochi, JP	36
Sanda, JP	28
FFPRIlocation not on record	22
Tsukuba, JP	17
Taipei, TW	14
Philadelphia, US	10
Taipei, TW	6
Taipei, TW	5
TAIElocation not on record	4
MeiseBGlocation not on record	4
Bronx, US	4
University of Stellenboschlocation not on record	4
South Kensington, GB	3
Auckland, NZ	3
College Park, US	3
Durham, US	2
Knoxville, US	2
Chiba, JP	2
Museum Of Natural And Environmental History, Shizuokalocation not on record	2
Vancouver, CA	1
Kew, GB	1
CASlocation not on record	1
Odawara, JP	1
Clemson, US	1
Chongqing Museumlocation not on record	1
Vitoria, ES	1
Dekalb, US	1
Akita Prefectural Museumlocation not on record	1
Kagoshima, JP	1
Universidad Católica de Santa Maríalocation not on record	1
Podgorica, ME	1
Long Beach, US	1
JP	1
Canadian Department of Agriculturelocation not on record	1
Tokushima, JP	1
Fukushima Universitylocation not on record	1
Bando, JP	1
Nishihara, JP	1
Sendai, JP	1
Nishihara, JP	1
KIRMlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Bangkok, TH	1

43 institutions · 195 of 209 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Corylopsis pauciflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–18.9

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–22.0

Min temp (night)3.00 °C 3.00–14.7

Precipitation344 mm/mo 328–344

Air humidity64.9 % 64.9–65.8

Moisture balance263 mm/mo 229–263

Vapour deficit428 Pa 428–751

Wind speed2.90 m/s 0.9–2.90

Cloud cover44.6 % 44.6–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)