Corydalis pumila

(Host) Rchb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Corydalis

At a glance

Occurrence records6 405

Data sources7

Biological traits26

DNA specimens11

eDNA detections48

Sources7 archives

Databases and archives Corydalis pumila's data was compiled from.

GBIFGlobal Biodiversity Information Facility6 405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF6 405 records

Environmental DNA3 datasets · 3 countries48 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB585 Mbp

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.15 m

⚠ sources differ — GIFT: 0.15 m · LEDA: 0.15 m · TRY: 0.175 m

Plant height generative0.15 m

Plant height max0.15 m

Plant height min0.1 m

Seed length2.09 mm

Seed mass1.76 mg

Life cycle & reproduction11

Deciduousnessalways spring green

Dispersal typeanimal

Flowering endApr

Flowering startMar

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Seed number21.3

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corydalis pumila has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences2

eDNA detections48

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMN662999.1 ↗522 bp

ACGT

CATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTGATGCCCCCGGTTGCGCCGGACGGTCGGCGGTCGTCGAAAGCCGCCCCC …

Corydalis pumila voucher O-392657 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Corydalis pumila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size585 303 061 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Corydalis pumila0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · ipcn-api-dl — Vachova, M. 1976. In Index of chromosome uumbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.

CCDB · book-atlas-flowering-plants — Ryberg 1950

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 405 records

Wild obs. + sensor5 141

Museum / vouchered1 236

Cultivated / captive7

Other21

Range

Area of Occupancy AOO9 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 3 718≤1 km 665≤10 km 625>10 km 20

5 028 georeferenced · 113 without coordinates

Open the mapobservation + sensor5 141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 235≤1 km 175≤10 km 160>10 km 59

629 georeferenced · 607 without coordinates

Open the institutions mapphysical evidence1 236

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	335
Olocation not on record	169
SLU Artdatabankenlocation not on record	155
Oskarshamn, SE	141
DBF-NHMDlocation not on record	53
BRNUlocation not on record	48
Adam Mickiewicz University in Poznańlocation not on record	46
KFGBlocation not on record	42
BIO-UNIPIlocation not on record	36
Uppsala, SE	35
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	29
Wlocation not on record	22
GJOlocation not on record	22
Trondheim, NO	19
Uniwersytet Wrocławskilocation not on record	14
NMBU:MINAlocation not on record	11
CJBGlocation not on record	8
Görlitz, DE	6
Kostrzyca Forest Gene Banklocation not on record	6
PRClocation not on record	4
Bergen, NO	4
Stockholm, SE	4
Provincia di Livornolocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
Salzburg, AT	2
Berlin, DE	2
MeiseBGlocation not on record	2
Dekalb, US	1
SZUlocation not on record	1
Bourges, FR	1
Columbia, US	1
Xiamen, CN	1
nbflocation not on record	1
BClocation not on record	1
Göteborg, SE	1
KMNlocation not on record	1
TROMlocation not on record	1
Tromso University Museumlocation not on record	1
Tampere, FI	1
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	1

40 institutions · 1 234 of 1 236 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA48 detections

Where the DNA of Corydalis pumila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 7.80–14.2

Seasonal swing summer↔winter19.9 °C

Max temp (day)12.1 °C 11.2–18.7

Min temp (night)6.00 °C 3.10–9.20

Precipitation45.8 mm/mo 35.6–48.6

Air humidity57.6 % 57.3–59.2

Moisture balance-34.1 mm/mo

Vapour deficit488 Pa 432–689

Wind speed2.80 m/s

Cloud cover42.6 % 31.5–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corydalis pumila

At a glance

Sources7 archives

Size & morphology6

Life cycle & reproduction11

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type6 405 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 405 records