Corydalis mucronifera

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Corydalis

At a glance

Occurrence records59

Data sources7

Biological traits18

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Corydalis mucronifera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF59 records

DNA & barcodingNCBIsequences

01Narrative

Corydalis mucronifera is a plant which does not have a common name as it is quite rare in nature. This plant has also previously been recorded as Corydalis boweri. Being as rare as it is, it has only been found in two regions: China and Tibet. The range where the plant can be found is small as it is only found near rocky beaches or high mountain ranges at altitudes between 4200 and 5300 meters. Corydalis mucronifera is small in size (about 5 cm) and displays a variety of colors: purple, yellow, white, and cream. The plant has similar structures to other plants found in Europe and North America as it displays a racemose corymb. Due to its herbal properties, it is currently being studied in medicine for its inhibitory properties; these properties are focused in studies regarding neurodegenerative disorders.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length5 mm

Fruit length max6 mm

Fruit length min4 mm

Fruit width2.4 mm

Fruit width max2.5 mm

Fruit width min2.3 mm

Plant height0.07 m

Plant height max0.13 m

Plant height min0.05 m

Life cycle & reproduction2

Life formperennial or subshrub

Life spanperennial

Habitat & environment7

Climatesubalpine or subarctic

Climberself-supporting

Elevation max5 300 m

Elevation mean4 275 m

Elevation min3 800 m

Growth formherb

Woodinessnon-woody

03Chemical composition28 compounds

Compounds documented for Corydalis mucronifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids5

Isoquinoline alkaloids $ Phthalide derivatives $ Tetrahydroisoquinoline alkaloids3

Amarylidaceae alkaloids1

Isoquinoline alkaloids $ Protopine alkaloids1

Flavones1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Galantamine	present	NPASS
(12S)-13,24-dimethyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-2,4(8),9,14(22),15,17(21)-hexaen-12-ol	present	LOTUS
(5R,8'S)-8'-hydroxy-6-methylspiro[7,8-dihydro-[1,3]dioxolo[4,5-g]isoquinoline-5,7'-8H-cyclopenta[g][1,3]benzodioxole]-6'-one	present	NPASS
(6S)-6-((5S)-5,6,7,8-Tetrahydro-6-methyl-1,3-dioxolo(4,5-g)isoquinolin-5-yl)furo(3,4-e)-1,3-benzodioxol-8(6H)-one	present	NPASS
Acetylcorynoline(P)	present	LOTUS
Bicuculline	present	NPASS
Chrysin	present	NPASS
Dihydrosanguinarine	present	NPASS
DTELHNAUJWFUDO-LEWJYISDSA-N	present	NPASS
DTELHNAUJWFUDO-NHCUHLMSSA-N	present	NPASS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corydalis mucronifera has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK302916.1 ↗224 bp

ACGT

CGCACCGAGTCGCCCCCATCCCTTGATCATGTTGACGAGGAGGCGGGAGCGGAGAATGGCCCCCCGTGCCCTCGTGCGCGGCCGGCCCAA …

Corydalis mucronifera isolate YP005NQ internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type59 records

Museum / vouchered54

Other5

Range

Area of Occupancy AOO140 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 16

16 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence54

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	16
GMBAlocation not on record	16
CASlocation not on record	5
Cambridge, US	5
Xining, CN	5
Kunming, CN	4
Yangling, CN	2
Xian, CN	1

8 institutions · 54 of 54 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)