Corydalis micrantha

(Engelm. & A.Gray) A.Gray ex J.M.Coult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Corydalis

At a glance

Occurrence records295

Data sources6

Biological traits11

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Corydalis micrantha's data was compiled from.

GBIFGlobal Biodiversity Information Facility295 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF295 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.904 mg

Life cycle & reproduction3

Life formannual or biennial

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corydalis micrantha has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV032790.1 ↗5 745 bpUSA · 2012

ACGT

ATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATA …

Corydalis micrantha voucher Phillippe LR et al. 43162 (PE) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Corydalis micrantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records12–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants — Ownbey 1951a

2n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Zhao, Z. 1996. Documented chromosome numbers 1996:2. Miscellaneous U. S. A. and Mexican species, mostly Asteraceae. Sida 17(1): 259–263.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type295 records

Wild obs. + sensor211

Museum / vouchered84

Range

Area of Occupancy AOO968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 110≤1 km 30≤10 km 12>10 km 19

171 georeferenced · 40 without coordinates

Open the mapobservation + sensor211

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 1≤1 km 3≤10 km 14>10 km 7

25 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Emporia, US	30
Austin, US	10
EL PASO, US	8
Miami, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Wuzhou, CN	6
St. Paul, US	3
Mexico City, MX	2
Chicago, US	2
Millersville, US	2
Claremont, US	2
Riverside, US	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1

14 institutions · 81 of 84 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)