Corydalis flexuosa

Franch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Corydalis

At a glance

Occurrence records65

Data sources6

Biological traits25

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Corydalis flexuosa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF65 records

DNA & barcodingNCBIsequences

01Narrative

Corydalis flexuosa is a species of flowering plant in the genus Corydalis, of the family Papaveraceae. It is a shade-loving perennial originating in woodland and mountainous areas of China. Growing to 30 cm, in spring it produces masses of bright blue tubular flowers with a white throat. It is summer dormant, meaning that the foliage dies down in summer. This plant is widely cultivated. It is hardy to USDA zones 5–8.Monrovia: China blue fumewort The cultivars 'Blue Panda' and 'Purple Leaf' have gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology17

Fruit length18.5 mm

Fruit length max22 mm

Fruit length min15 mm

Fruit width1.25 mm

Fruit width max1.5 mm

Fruit width min1 mm

Inflorescence length max13 cm

Inflorescence length min6 cm

Leaf length55 mm

Leaf length max60 mm

Leaf length min50 mm

Leaf width55 mm

Leaf width max60 mm

Leaf width min50 mm

Plant height0.45 m

Plant height max0.5 m

Plant height min0.4 m

Life cycle & reproduction1

Life formrhizomatous geophyte

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 800 m

Elevation mean2 325 m

Elevation min1 300 m

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corydalis flexuosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV032725.1 ↗5 734 bpChina · 2013

ACGT

ATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATA …

Corydalis flexuosa voucher Zhang SR et al. 0008 (PE) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor1

Museum / vouchered64

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	29
Chengdu, CN	13
Chengdu, CN	9
Denver, US	3
Guilin, CN	2
Kunming, CN	2
Nanchong, CN	2
Nanjing, CN	2
Yangling, CN	1
Long Beach, US	1

10 institutions · 64 of 64 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)