Corydalis caucasica

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Corydalis

At a glance

Occurrence records663

Data sources4

Biological traits14

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Corydalis caucasica's data was compiled from.

GBIFGlobal Biodiversity Information Facility663 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF663 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.2 m

Plant height min0.1 m

Seed mass1.35 mg

Seed mass max1.35 mg

Seed mass min1.35 mg

Life cycle & reproduction4

Flowering endMay

Flowering startApr

Life formtuberous geophyte

Life spanperennial

Habitat & environment5

Climatetemperate

Growth formherb

Habitat GIFTforest, shrubberies

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corydalis caucasica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV032687.1 ↗5 789 bpRussia · 2009

ACGT

ATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATA …

Corydalis caucasica voucher Zernov et al. s.n. (MW) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type663 records

Wild obs. + sensor599

Museum / vouchered62

Cultivated / captive2

Origin

Native2

Range

Area of Occupancy AOO1 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 248≤1 km 75≤10 km 37>10 km 18

378 georeferenced · 221 without coordinates

Open the mapobservation + sensor599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤1 km 14≤10 km 18>10 km 2

34 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence62

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	50
Saint Louis, US	2
Zürich, CH	1
Bronx, US	1
Batumi Botanical Gardenlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Institute of Botany, Ilia State Universitylocation not on record	1

7 institutions · 57 of 62 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)