Corybas walliae — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Corybas

At a glance

Occurrence records175

Data sources4

Biological traits2

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Corybas walliae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility175 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF175 records

DNA & barcodingNCBIsequences

01Narrative

Corybas walliae, commonly known as Zeller's spider orchid, is a species of orchid endemic to New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formtuberous geophyte

Habitat & environment1

Climatesubtropical

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corybas walliae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX499842.1 ↗552 bpNew Zealand

ACGT

GGTGCATGCCGTTGCCAAACACCCTCTCTTTGTCTTATCTTCTTGAATGAAGTGGTGGCATAGAGTTTGGGTGGAAAATAAAGCCGGCGC …

Corybas walliae voucher WELT:SP104124 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS5

fungal barcode

08Occurrence & distribution

Record type175 records

Wild obs. + sensor137

Museum / vouchered38

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 46≤1 km 44≤10 km 6>10 km 10

106 georeferenced · 31 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 38 records without

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	37
Christchurch, NZ	1

2 institutions · 38 of 38 vouchered records shown