Corybas trilobus

(Hook.f.) Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Corybas

At a glance

Occurrence records2 242

Data sources6

Biological traits15

DNA specimens0

eDNA detections5

Sources6 archives

Databases and archives Corybas trilobus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF2 242 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingNCBIsequences

01Narrative

Corybas trilobus is a species of terrestrial orchid endemic to New Zealand. It is part of the C. trilobus aggregate, whose members are characterized by a funnel or dish-shaped labellum and an often heart or kidney-shaped solitary leaf.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Leaf length max18 mm

Plant height0.03 m

⚠ sources differ — GIFT: 0.03 m · TRY: 0.05 m

Plant height max0.05 m

Life cycle & reproduction4

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corybas trilobus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX499810.1 ↗552 bpNew Zealand

ACGT

GGTGCATGCCGTTGCCAAACACCCTCTCTTTGTCTTATCTTCTTGAATGAAGTGGTGGCATAGAGTTTGGGTGGAAAATAAAGCCGGCGC …

Corybas trilobus voucher WELT:SP104195 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type2 242 records

Wild obs. + sensor1 927

Museum / vouchered315

Range

Area of Occupancy AOO5 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 818≤1 km 53≤10 km 11>10 km 15

1 897 georeferenced · 30 without coordinates

Open the mapobservation + sensor1 927

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 2

4 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	127
Wellington, NZ	122
Auckland, NZ	43
Rotorua, NZ	17
Smithfield, AU	2
Hobart, AU	1
Tampa, US	1
Canberra, AU	1
Honolulu, US	1

9 institutions · 315 of 315 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Corybas trilobus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corybas trilobus

At a glance

Sources6 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

At a glance

Record type2 242 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 242 records