Corybas sanctigeorgianus — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Corybas

At a glance

Occurrence records47

Data sources4

Biological traits2

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Corybas sanctigeorgianus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility47 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF47 records

DNA & barcodingNCBIsequences

01Narrative

Corybas sanctigeorgianus is a species of terrestrial orchid endemic to the North Island of New Zealand. It is part of the C. trilobus aggregate, whose members are characterized by a funnel or dish-shaped labellum and an often heart or kidney-shaped solitary leaf.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formtuberous geophyte

Habitat & environment1

Climatesubtropical

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corybas sanctigeorgianus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX499835.1 ↗552 bpNew Zealand

ACGT

GGTGCATGCCGTTGCCAAACACCCTCTCTTTGTCTTATCTTCTTGAATGAAGTGGTGGCATAGAGTTTGGGTGGAAAATAAAGCCGGCAC …

Corybas sanctigeorgianus voucher WELT:SP104167 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor47

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 25≤1 km 14≤10 km 3>10 km 5

47 georeferenced

Open the mapobservation + sensor47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.