Corybas recurvus

D.L.Jones · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Corybas

At a glance

Occurrence records307

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Corybas recurvus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility307 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF307 records

DNA & barcodingNCBIsequences

01Narrative

Corybas recurvus, commonly known as the western helmet orchid or common helmet is a species of terrestrial orchid endemic to Western Australia. It has round or heart-shaped leaf and a dark reddish purple or purplish black flower. It is widespread and common between Bunbury and Albany.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length27.5 mm

Leaf width29.5 mm

Plant height0.03 m

Plant height max0.03 m

Plant height min0.01 m

Life cycle & reproduction5

Flowering timennnnnnyyynnn

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapecordate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corybas recurvus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT844557.1 ↗695 bpAustralia · 2011

ACGT

ATCATTGTCGAGACCCGAAACACCGAGCGATTTGACAACTTGTGAACAACCAATGAGGCAACGGTGCATGCCGATGCCAAACACCCTTCT …

Corybas recurvus isolate SLE417 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type307 records

Wild obs. + sensor210

Museum / vouchered96

Cultivated / captive1

Origin

Native3

Range

Area of Occupancy AOO696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 95≤1 km 21≤10 km 9>10 km 20

145 georeferenced · 65 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 17≤1 km 7≤10 km 54>10 km 6

84 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence96

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	59
Canberra, AU	22
Museo Entomologico de Leonlocation not on record	10
Mount Annan, AU	3
Adelaide, AU	1
BGPAlocation not on record	1

6 institutions · 96 of 96 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)