Corybas oblongus

(Hook.f.) Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Corybas

At a glance

Occurrence records2 123

Data sources7

Biological traits8

DNA specimens2

eDNA detections3

Sources7 archives

Databases and archives Corybas oblongus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF2 123 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Corybas oblongus is a species of terrestrial orchid endemic to New Zealand. It has a solitary oval-shaped leaf, often patterned with maroon, and a reddish-purple and white flower with a fimbriate labellum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corybas oblongus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX499850.1 ↗555 bpNew Zealand

ACGT

GGCTTCCGCCGTCGCCGGGCGCCCTTCCCTCCGTCTTGCCTCCCAGAACGGGGTCGCGGTGTGGGGCTCGGGCGGAAACCAAAACCGGCG …

Corybas oblongus voucher WELT:SP104170 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type2 123 records

Wild obs. + sensor1 826

Museum / vouchered297

Range

Area of Occupancy AOO3 948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 896≤1 km 360≤10 km 145>10 km 135

1 536 georeferenced · 290 without coordinates

Open the mapobservation + sensor1 826

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 1≤10 km 4>10 km 4

10 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence297

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	133
Wellington, NZ	94
Auckland, NZ	50
Rotorua, NZ	12
Museo Entomologico de Leonlocation not on record	4
Tampa, US	1
Chicago, US	1
Canberra, AU	1
Smithfield, AU	1

9 institutions · 297 of 297 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Corybas oblongus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corybas oblongus

At a glance

Sources7 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

At a glance

Record type2 123 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 123 records