Corticeus pini

(Panzer, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Tenebrionidae/Corticeus

At a glance

Occurrence records2 232

Data sources5

Biological traits0

DNA specimens5

eDNA detections3

Sources5 archives

Databases and archives Corticeus pini's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 232 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Corticeus pini has left across the world's sequence archives.

At a glance

DNA specimens5

BINs3

Marker genes1

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P631 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

3Cmostly conserved

18Tmostly conserved

33Gmostly conserved

39Avariable

42Amostly conserved

45Amostly conserved

60Avariable

78Cvariable

85Tmostly conserved

93Gmostly conserved

99Tvariable

111Tvariable

120Tmostly conserved

135Cmostly conserved

153Amostly conserved

165Cmostly conserved

168Amostly conserved

180Tmostly conserved

183Amostly conserved

192Gmostly conserved

198Tmostly conserved

201Tmostly conserved

216Avariable

231Amostly conserved

234Amostly conserved

243Cmostly conserved

252Tmostly conserved

259Cvariable

267Tmostly conserved

271Cmostly conserved

294Amostly conserved

303Gmostly conserved

315Amostly conserved

318Tmostly conserved

324Amostly conserved

330Tmostly conserved

357Amostly conserved

384Amostly conserved

390Cvariable

396Amostly conserved

400Cmostly conserved

402Amostly conserved

408Amostly conserved

411Cmostly conserved

417Amostly conserved

426Avariable

432Tmostly conserved

441Tmostly conserved

444Tmostly conserved

459Gmostly conserved

462Avariable

465Cvariable

468Amostly conserved

477Tmostly conserved

510Tmostly conserved

514Tmostly conserved

526Cmostly conserved

528Tmostly conserved

534Amostly conserved

535Tmostly conserved

537Avariable

540Amostly conserved

543Amostly conserved

549Tmostly conserved

550Cmostly conserved

561Cvariable

571Tmostly conserved

574Cmostly conserved

585Amostly conserved

589Tmostly conserved

597Cmostly conserved

603Cmostly conserved

609Tvariable

618Avariable

TACTTTATTTTTGGAGCTTGATCAGGAATAGTGGGCACATCACTAAGACTTTTAATTCGAGCTGAATTAGGAAACCCCGGATCATTAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.3%

Haplotypes4

BINs3

Most divergent pair10.9%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Corticeus fraxinisame genus10.8%Atheta triangulumsame order14.3%Graphoderus perplexussame order14.7%Carcelia tibialissame order15.1%Poecilopharis leaisame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 232 records

Wild obs. + sensor1 276

Museum / vouchered34

Fossil1

Other921

Origin

Native21

Range

Area of Occupancy AOO2 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 26≤1 km 32≤10 km 433>10 km 15

506 georeferenced · 770 without coordinates

Open the mapobservation + sensor1 276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 3≤10 km 2>10 km 1

6 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tallinn, EE	8
Muzeum Górnośląskie w Bytomiulocation not on record	8
Helsinki, FI	4
MZLUlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Geneva, CH	1
IFR-DNFlocation not on record	1
Department of Molecular Biodiversity, Institute of Systematics and Evolution of Animals of the Polish Academy of Scienceslocation not on record	1
SLU Artdatabankenlocation not on record	1

10 institutions · 30 of 34 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Corticeus pini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.20 °C 7.80–17.9

Seasonal swing summer↔winter16.9 °C

Max temp (day)11.6 °C 11.1–22.2

Min temp (night)4.60 °C 3.90–13.4

Precipitation70.2 mm/mo 58.0–70.3

Air humidity60.7 % 60.5–62.7

Moisture balance10.4 mm/mo -60.9–34.6

Vapour deficit447 Pa 431–844

Wind speed3.20 m/s 3.20–3.40

Cloud cover48.8 % 37.0–53.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Corticeus pini

At a glance

Sources5 archives

At a glance

Record type2 232 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 232 records