Coronilla valentina
speciesAt a glance
Occurrence records3 703
Data sources12
Biological traits30
DNA specimens1
eDNA detections5
Sources12 archives
Databases and archives Coronilla valentina's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 703 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources30 traits
Chemical compositionLOTUS14 compounds
Occurrence & distributionGBIF3 703 records
Environmental DNA1 datasets · 2 countries5 detections
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB2n = 24
01Narrative
Coronilla valentina, la Coronille de Valence, est une espèce de plantes à fleurs de la famille des Fabaceae. C’est un arbrisseau, de moins d’un mètre de hauteur pour l’espèce sauvage ; le cultivar ornemental est plus grand. Elle pousse dans les habitats secs et rocailleux, tels que les garrigues et les maquis.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology9
Fruit length max120 mm
Fruit length min9 mm
Leaf length max25 mm
Leaf length min7 mm
Leaf width max15 mm
Leaf width min3 mm
Plant height0.8 m
Plant height max2 m
Seed mass6.97 mg
Life cycle & reproduction9
Deciduousnessdeciduous
Dehiscencedehiscent
Flower colouryellow
Flowering endMay
Flowering startJan
Life formsubshrub or shrub
Life spanperennial
Lifespan years6 years
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formshrub
Leaf formobovate
Woodinesswoody
Physiology & chemistry1
Photosynthetic pathwayC3
03Chemical composition14 compounds
Compounds documented for Coronilla valentina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Cardenolides10
Flavonols4
Documented compounds14 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3S,5S,8R,9S,10R,13R,14S,15R,17R)-14,15-dihydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| (3S,5S,8R,9S,10R,13R,14S,17R)-14-hydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| (3S,5S,8R,9S,10R,13R,14S,17R)-3-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-14-hydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| (3S,5S,8R,9S,10R,13R,14S,17S)-14-hydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| (3S,5S,8R,9S,10S,13R,14S,17R)-3-[(2R,3R,4R,5R)-5-[(1R)-1,2-dihydroxyethyl]-3,4-dihydroxyoxolan-2-yl]oxy-5,14-dihydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-2,3,4,6,7,8,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| (3S,5S,8R,9S,10S,13R,14S,17R)-3-[(2R,3R,4S,5R)-5-[(1R)-1,2-dihydroxyethyl]-3,4-dihydroxyoxolan-2-yl]oxy-5,14-dihydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-2,3,4,6,7,8,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| 3-[(3S,5S,8R,9S,10R,13R,14S,17R)-14-hydroxy-10-(hydroxymethyl)-13-methyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl]-2H-furan-5-one | present | LOTUS | |
| 3-[(3S,5S,8R,9S,10R,13R,14S,17R)-3-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-14-hydroxy-10-(hydroxymethyl)-13-methyl-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl]-2H-furan-5-one | present | LOTUS | |
| 3-[(3S,5S,8R,9S,10R,13R,14S,17R)-3-[(2R,3R,4S,5R)-5-[(1R)-1,2-dihydroxyethyl]-3,4-dihydroxyoxolan-2-yl]oxy-5,14-dihydroxy-10-(hydroxymethyl)-13-methyl-2,3,4,6,7,8,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]-2H-furan-5-one | present | LOTUS | |
| 5,7,8-trihydroxy-2-(4-hydroxy-3-methoxyphenyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coronilla valentina has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes2
GenBank sequences6
eDNA detections5
Countries2
The DNA barcodea real sequence read deposited for this species
TCGCACCTCACTCAAAGAGCAAACCAACCCGCGAACACGTTCGACCACTCATTCAGGGGAAGGGCCTCGGGACGTGCGCGCCACGCACCA …
Coronilla valentina internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL1★ITS5
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Coronilla valentina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidypolyploid inferred
Chromosome records12–242n range24median24mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2416×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · ipcn-api-dl — Schmidt, B. 1979. Beiträge zur Kenntnis der Sippenstruktur der Gattung Coronilla L. Feddes Repert. 90: 257–361.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Fernandez Casas, J., J. F. PIQUERAS & M. R. Rejon. 1977. Estudios cariologicos sobre la flora espanola, III. Lagascalia 7: 77–81.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn75-78 — Natarajan 1977
CCDB · book-ipcn75-78 — Natarajan 1978
CCDB · book-ipcn75-78 — Fernandez Casas et al. 1977
CCDB · book-atlas-flowering-plants — Atchison 1949a
CCDB · CromoCat 2015 — Fernández Casas, J., Fernández Piqueras, J. & Ruíz Rejón, M. (1977). Estudios cariológicos sobre la flora española, III. Lagascalia 7(1): 77-81.
CCDB · CromoCat 2015 — Motzkus, B. (1974). Beiträge zur kenntnis einiger chromosomenzahlen der gattung Coronilla L. Feddes Repert. 84: 741-746.
CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.
2n 1215×CCDB · ita-fl · CCDB · mediterranean · CCDB · ipcn-api-dl +5
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 239-250.. Anales Jard. Bot. Madrid , 40(1): 263-270.
CCDB · ita-fl — PECCENINI S. - 2004 (2004). Indagini biosistematiche su Coronilla valentina L. s.l. (Leguminosae).. Informatore Botanico Italiano , 36(2): 486-488.
CCDB · ita-fl — ARRIGONI P.V., MORI B. - 1971. Numeri cromosomici per la flora italiana:92-97.. Inform. Bot. Ital. , 3(3): 226-233.
CCDB · mediterranean
CCDB · ipcn-api-dl — Baltisberger, M., A. Mullaj & V. Tartari. 1993. Mediterranean chromosome number reports 3 (185--203). Fl. Medit. 3: 348–353.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn67-71 — BORSOS, o. 1970. Contributions to the knowledge on the chromosome numbers of Phanerogams growing in Hungary and southeastern Europe. Acta Bot. Acad. Sci. Hung. 16: 255-265.
CCDB · book-ipcn67-71 — ARRIGONI, P.V., & B. MORI. 1971. In Numeri cromosomici per la flora Italiana. Inf. Bot. Italiano 3: 226-233.
CCDB · book-ipcn73-74 — SZ.-BORSO~, o. 1970. Contributions to the knowledge on the chromoso~ numbers of phanerogams growing in Hungary and south-eastern Europe. Acta. Bot. Acad. Sci. Hung. 16(3-4): 255-265. I
CCDB · Cave1956 — Larsen a
CCDB · Cave1957 — Frahm-Leliveld
CCDB · CromoCat 2015 — Baltisberger, M., Mullaj, A. & Tartari, V. (1993). Mediterranean chromosome number reports 3 (185--203). Fl. Medit. 3: 348-353.
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
n 122×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Estudios cariolgicos sobre la flora espaola. III Fernndez Casas, J., J. Fernndez Piqueras & M. Ruz Rejn.Lagascalia7(1): 77-81(1977).
CCDB · CromoCat 2015 — Fernández Casas, J., Fernández Piqueras, J. & Ruíz Rejón, M. (1977). Estudios cariológicos sobre la flora española, III. Lagascalia 7(1): 77-81.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 703 records
Wild obs. + sensor3 448
Museum / vouchered221
Other34
Origin
Introduced32
Range
Area of Occupancy AOO6 576 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 1 137≤1 km 129≤10 km 1 625>10 km 33
2 924 georeferenced · 524 without coordinates
Open the mapobservation + sensor3 448
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 8≤1 km 14≤10 km 16
38 georeferenced · 183 without coordinates
Open the institutions mapphysical evidence221
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions16 of 35 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 99 |
| LDlocation not on record | 36 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| BClocation not on record | 10 |
| Córdoba, ES | 7 |
| UIBlocation not on record | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| València, ES | 3 |
| MeiseBGlocation not on record | 3 |
| Vitoria, ES | 3 |
| Oskarshamn, SE | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Berlin, DE | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Riverside, US | 2 |
| Barcelona, ES | 2 |
| Wlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| San Jose, US | 1 |
| Salamanca, ES | 1 |
| Badajoz, ES | 1 |
| Dresden, DE | 1 |
| Sevilla, ES | 1 |
| Kew, GB | 1 |
| BDBClocation not on record | 1 |
| South Kensington, GB | 1 |
| Coimbra, PT | 1 |
| CJBGlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| MAlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| ISAlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
35 institutions · 215 of 221 vouchered records shown · 6 without an institution code
09Environmental DNA5 detections
Where the DNA of Coronilla valentina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map2 countries0
Non coniferous evergreen forests
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 15.2–19.3
Seasonal swing summer↔winter21.1 °C
Max temp (day)20.1 °C 20.1–24.1
Min temp (night)9.00 °C 9.00–13.4
Precipitation33.4 mm/mo 33.4–38.1
Air humidity52.9 % 52.9–53.6
Moisture balance-61.7 mm/mo -104–-61.7
Vapour deficit953 Pa 953–1,095
Wind speed2.00 m/s 2.00–2.70
Cloud cover38.3 % 38.3–38.9
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.