Coronilla scorpioides
(L.) W.D.J.Koch · speciesAt a glance
Occurrence records19 004
Data sources13
Biological traits26
DNA specimens1
eDNA detections1
Sources13 archives
Databases and archives Coronilla scorpioides's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility19 004 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources26 traits
Chemical compositionLOTUS · NPASS88 compounds
Occurrence & distributionGBIF19 004 records
Environmental DNA1 datasets · 0 countries1 detections
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB2n = 12
01Narrative
Coronilla scorpioides, the yellow crownvetch, is a species of annual herb in the family Fabaceae. They have a self-supporting growth form and compound, broad leaves. Individuals can grow to 20 cm tall.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDATRYGIFTWCVP
Size & morphology4
Plant height0.25 m
Plant height max0.4 m
Plant height min0.05 m
Seed mass1.4 mg
Life cycle & reproduction9
Deciduousnessdeciduous
Dispersal typehuman
⚠ sources differ — LEDA: speirochor · GIFT: unspecialized
Flowering endJun
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Raunkiær life formtherophyte
Seed number15.25
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max2 000 m
Epiphyteterrestrial
Growth formherb
Habitat GIFThills, mountains
Mycorrhiza type0.00000000596
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)139 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)21.14 mm²/mg
03Chemical composition88 compounds
Compounds documented for Coronilla scorpioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cardenolides20
Cycloeudesmane sesquiterpenoids15
Eudesmane sesquiterpenoids5
Labdane diterpenoids4
Cycloeudesmane sesquiterpenoids $ Eudesmane sesquiterpenoids4
Documented compounds88 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Marmesin | present | LOTUS | |
| (1aR,4R,4aR,7S,7aS,7bR)-Decahydro-1,1,4,7-tetramethyl-1H-cycloprop(e)azulene-4,7-diol | present | NPASS | |
| (1R,4aS,5S,8aR)-5-(hydroxymethyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,2S,4S,5S,7R,8S,9R,10S,16R,28E,33S,34S,36R,37R)-4,9,10,33-tetrahydroxy-1,8,13,28-tetramethyl-11,17,21,26,31-pentaoxadecacyclo[17.17.3.14,8.02,16.05,7.010,14.016,39.033,37.034,36.015,40]tetraconta-13,15(40),19(39),28-tetraene-12,18,22,25,30-pentone | present | NPASS | |
| (1S,4aR,5S,8aR)-5-[(E)-5-hydroxy-3-methyl-2-oxopent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aR,5S,8aR)-5-[(E,2R)-2,5-dihydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aR,5S,8aR)-5-[(E,2S)-2,5-dihydroxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4aS,5R,8aS)-5-[(E,2R)-2-hydroxy-5-methoxy-3-methylpent-3-enyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1S,4S,5E,7S)-4-methyl-10-methylidene-7-propan-2-ylcyclodec-5-ene-1,4-diol | present | NPASS | |
| (3S,5S,8R,9S,10R,13R,14S,15R,17R)-14,15-dihydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Coronilla scorpioides has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes2
GenBank sequences4
eDNA detections1
Countries1
The DNA barcodea real sequence read deposited for this species
TCGTATCCTCACAATCAAGGCAACCTGTGGACATGTTTGACTATTTGGGCAGGCCTGGGGTGTATTCCACCTCAACCTCCCAAGTCAGGG …
Coronilla scorpioides internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★ITS3
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Coronilla scorpioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidydiploid inferred
Chromosome records12–122n range12median12mode37records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1237×CCDB · ita-fl · CCDB · iber-fl · CCDB · nw-europe-fl +8
CCDB · ita-fl — HRUSKA K., BELLOMARIA B. - 1982. Numeri cromosomici per la flora italiana:877-881.. Inform. Bot. Ital. , 14(2-3): 238-242.
CCDB · ita-fl — LARSEN K. - 1955. Cytotaxonomical studies on the Mediterranean flora.. Bot. Not. , 108(2): 263-275.
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2887
CCDB · fl-europaea — Larsen, 1955b
CCDB · mediterranean
CCDB · ipcn-api-dl — Hru;abska, K. & B. Bellomaria. 1982. Numeri cromosomici per la Flora Italiana: 877-881. Inform. Bot. Ital. 14: 238–242.
CCDB · ipcn-api-dl — Schmidt, B. 1979. Beiträge zur Kenntnis der Sippenstruktur der Gattung Coronilla L. Feddes Repert. 90: 257–361.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1996. Chromosome numbers of North African phanerogams. VI. Some counts in Leguminosae. Willdenowia 25: 669–680.
CCDB · ipcn-api-dl — Runemark, H. 2006. Mediterranean chromosome number reports 16 (1473--1571). Fl. Medit. 16: 408–425.
CCDB · book-ipcn72 — KOZUHAROV, S.I., B.A. KUZMANOV, T. MARKOVA. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn75-78 — Krusheva 1975
CCDB · book-ipcn75-78 — Natarajan 1978
CCDB · book-ipcn75-78 — Kozuharov et al. 1975a
CCDB · book-ipcn75-78 — Natarajan 1977
CCDB · book-ipcn73-74 — MOTZKUS, B. 1973. Beitrage zur Kenntnis einiger Chromosomenzahlen de Gattung Coronilla L. Feddes Repert. 84: 741-746.
CCDB · Cave1956supp — Larsen 1955b
CCDB · CromoCat 2015 — Runemark, H. (2006). Reports (1473-1571). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 408-425
CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1983a). Números cromosomáticos de plantas occidentales, 200-210. Anales Jard. Bot. Madrid 39: 519-524.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Hruska, K. & Bellomaria, B. (1982). Numeri cromosomici per la flora italiana: 877-881. Inf. Bot. Ital. 14: 238-242.
CCDB · CromoCat 2015 — Larsen, K. (1955a). Cytotaxonomical studies on the mediterranean flora. Bot. Not. 108: 263-275.
CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.
CCDB · CromoCat 2015 — Schmidt, B. (1979a). Beiträge zur Kenntnis der Sippenstruktur der Gattung Corononilla L. Feddes Repert. 90: 258-354.
CCDB · CromoCat 2015 — Guinochet, M. & Lefranc, M. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 853-854.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
CCDB · CromoCat 2015 — Krusheva, R. M. (1975). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports L]. Taxon 24(5/6): 676-677.
CCDB · CromoCat 2015 — Kozuharov, S., Petrova, A. & Markova, T. (1975a). Cytotaxonomic study on Bulgarian Leguminosae species. In: In honour acad. D. Jordanov : 31-47.
CCDB · CromoCat 2015 — Krusheva, R. (1985). Sravnitelni citoembriologicni proucvanija na vidove ot sem. Fabaceae. IV. God. Sof. Univ. Biol. Fak. 76(2): 3-24.
CCDB · CromoCat 2015 — Krusheva, R. (1988). Comparative cytoembryological study of Fabaceae VI. Ann. Univ. Sof. Fac. Biol. Geol. Georg. 79(2): 11-27.
CCDB · CromoCat 2015 — Kozuharov, S., Kuzmanov, B. & Markova, T. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 336-337.
n 64×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Schmidt, B. 1979. Beiträge zur Kenntnis der Sippenstruktur der Gattung Coronilla L. Feddes Repert. 90: 257–361.
CCDB · book-ipcn73-74 — MOTZKUS, B. 1973. Beitrage zur Kenntnis einiger Chromosomenzahlen de Gattung Coronilla L. Feddes Repert. 84: 741-746.
CCDB · CromoCat 2015 — Motzkus, B. (1974). Beiträge zur kenntnis einiger chromosomenzahlen der gattung Coronilla L. Feddes Repert. 84: 741-746.
CCDB · CromoCat 2015 — Schmidt, B. (1979a). Beiträge zur Kenntnis der Sippenstruktur der Gattung Corononilla L. Feddes Repert. 90: 258-354.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type19 004 records
Wild obs. + sensor16 647
Museum / vouchered1 950
Cultivated / captive53
Other354
Origin
Native2 001
Range
Area of Occupancy AOO35 548 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 2 075≤1 km 3 196≤10 km 7 200>10 km 102
12 573 georeferenced · 4 074 without coordinates
Open the mapobservation + sensor16 647
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 64≤1 km 336≤10 km 244>10 km 9
653 georeferenced · 1 297 without coordinates
Open the institutions mapphysical evidence1 950
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 10>10 km 2
12 georeferenced · 41 without coordinates
Open the mapnot free-living53
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions53 of 95 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 306 |
| Berlin, DE | 236 |
| LDlocation not on record | 172 |
| MAlocation not on record | 150 |
| València, ES | 114 |
| BClocation not on record | 61 |
| Moscow State Universitylocation not on record | 54 |
| Barcelona, ES | 49 |
| BDBClocation not on record | 48 |
| Jaén, ES | 47 |
| Entomological Society of Latvialocation not on record | 43 |
| Granada, ES | 43 |
| Vitoria, ES | 33 |
| Córdoba, ES | 31 |
| CICYTEXlocation not on record | 30 |
| Wlocation not on record | 27 |
| UIBlocation not on record | 23 |
| Sevilla, ES | 23 |
| Madrid, ES | 23 |
| ISAlocation not on record | 20 |
| Badajoz, ES | 20 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 19 |
| Salamanca, ES | 19 |
| Pamplona, ES | 19 |
| Phyletisches Museum Jenalocation not on record | 18 |
| College of the Atlantic, Museumlocation not on record | 17 |
| Alicante, ES | 16 |
| Pamplona, ES | 14 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 14 |
| BRNUlocation not on record | 12 |
| EEZA-CSIClocation not on record | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 11 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| Paris, FR | 9 |
| Turku, FI | 9 |
| Kew, GB | 8 |
| Museo Achille Folettolocation not on record | 7 |
| GJOlocation not on record | 6 |
| MeiseBGlocation not on record | 6 |
| Helsinki, FI | 6 |
| OLAlocation not on record | 5 |
| South Kensington, GB | 5 |
| CJBGlocation not on record | 5 |
| Bern, CH | 4 |
| Bratislava, SK | 4 |
| Bourges, FR | 4 |
| BG-NMNHSlocation not on record | 4 |
| Görlitz, DE | 4 |
| Santiago de Compostela, ES | 3 |
| Xiamen, CN | 3 |
| Brussel, BE | 3 |
| San Sebastián, ES | 3 |
| Durham, US | 3 |
| JBSlocation not on record | 3 |
| Karlsruhe, DE | 2 |
| Jyväskylä, FI | 2 |
| Sant Julià de Lòria, AD | 2 |
| Provincia di Livornolocation not on record | 2 |
| Bronx, US | 2 |
| Frankfurt am Main | 2 |
| Stockholm, SE | 2 |
| Saint Louis, US | 2 |
| Monastir, TN | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| Uppsala, SE | 2 |
| Dresden, DE | 2 |
| ESP003location not on record | 1 |
| CASlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| San Francisco, US | 1 |
| BFLlocation not on record | 1 |
| Mlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Saint John, CA | 1 |
| Trondheim, NO | 1 |
| Rishon Le Zion, IL | 1 |
| TUR-Alocation not on record | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| PRClocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Coimbra, PT | 1 |
| Bergen, NO | 1 |
| Madrid, ES | 1 |
| GZUlocation not on record | 1 |
| H-Merxmlocation not on record | 1 |
| Montréal, CA | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Glarus, CH | 1 |
| Oulu, FI | 1 |
| Salzburg, AT | 1 |
| Podgorica, ME | 1 |
| EL PASO, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Boumlocation not on record | 1 |
95 institutions · 1 893 of 1 950 vouchered records shown · 56 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA1 detections
Where the DNA of Coronilla scorpioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.